Answer:
laws.
Explanation:
hypothesis is an educated guess
therous are ideas
and laws are supported by observations. like newton's law.
Amines, these are simple molecules.
proteins and peptides which are made from chains of amino acids.
steroids which are derived from cholesterol.
That’s the way girls and boy hormones differ
Desert vegetation or xerophytes includes bushes with deep roots and plants that store water.
Another name for desert plant:
A plant species known as a xerophyte has evolved to live in environments with little fluid water, like a desert or an area surrounded by ice or frost in the Mountains or the Polar regions. Cacti, pineapples, and various Gymnosperm species are a few well-known instances of xerophytes.
- Xerophytes have different adaptations to their morphological characters (morphology) and basic physiological functions (physiology) that allow them to store significant amounts of water and save it during dry seasons. During prolonged periods of severe dehydration or evaporation of their organs, some creatures can live, and at those times, their biochemical function may cease. Xeromorphic flora has such biological and morphological modifications.
Learn more about xerophyte here:
brainly.com/question/4782897
#SPJ4
Answer:
A. Sediment
Explanation:
As water flows, it both breaks down rocks and picks up soil. When the pieces of rock and soil are travelling in water, they are called sediment.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
