The answer is Transcription.
Transcription is the first step to gene expression. This
process happens when a certain part of the DNA is being copied into RNA. This
process allows the DNA to at least transfer at least one gene to the RNA
The nitrogen base will be uracil
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
A water molecule consists of two hydrogen atoms and one oxygen atom. ... This molecular structure leads to hydrogen bonding, which is a stabilized structure in which a hydrogen atom is in a line between the oxygen atom on its own molecule and the oxygen on another molecule.
Explanation:
It’s earthquake area becusse it right by the ocean cause the plates underground to rumble causing a earth quake