1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fredd [130]
4 years ago
7

Think about how the geologic time scale was created and how it is divided. Then answer the following questions.

Biology
2 answers:
katovenus [111]4 years ago
9 0
The geologist time scale was formed when scientists studied rock layers and index fossils worldwide. With this information, they placed Earth's rocks in order by relative age. Later, radioactive dating helped determine the exact age of the divisons in the geologic time scale.

This scale is organized by the 4.6 billion years of earth's history into sections based on important changes seen in the geologic record. The largest intervals are called eons, with each eon containing many millions of years.

In precambarian time the processes that affect Earth's surface have lessened the erosion on the surface. Earth was being hit by meteorites every second. Now there is water erosion and there wasn't back then. The surface changes have lessened over time.
Cat 101
2 years ago
Wow! Thank you so so much!
8_murik_8 [283]4 years ago
3 0

Answer:

a. The formation of the geological time scale was done by the scientists by illustrating the order and time that when the prime Earth events took place for the last 4.5 billion years ago. The scale illustrates the first time plants originated on Earth, the first time animals were seen on the planet, the procedures, which produced mountains and the extinction of unique species like dinosaurs.  

b. The geological time scale is arranged into intervals, which are known as Eons, Eras, Periods, and Ages. Of these, the Eons is the largest interval, where each eon signifies many millions of years. The Eons are differentiated into Eras that begin and terminate with substantial modifications in the living species on the surface of the Earth. In each Era, there exist various periods that are further subdifferential into various short epochs.  

c. The procedures, which modified the surface of the Earth at the time of Precambrian time was variations in climatic condition, which resulted due to development of the planet, and afterward due to the origination of complex and multicellular species.  

You might be interested in
What is the name of the process of DNA formation from DNA?. A:transcription. B:translation. C:transduction
forsale [732]

The answer is Transcription.

Transcription is the first step to gene expression. This process happens when a certain part of the DNA is being copied into RNA. This process allows the DNA to at least transfer at least one gene to the RNA

4 0
4 years ago
Read 2 more answers
If dna strand has an adenine , which nitrogen base will pair when RNa is made
pshichka [43]
The nitrogen base will be uracil
4 0
4 years ago
(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
Hatshy [7]

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

4 0
3 years ago
Read 2 more answers
Structure of a Water molecule
Alisiya [41]

Answer:

A water molecule consists of two hydrogen atoms and one oxygen atom. ... This molecular structure leads to hydrogen bonding, which is a stabilized structure in which a hydrogen atom is in a line between the oxygen atom on its own molecule and the oxygen on another molecule.

Explanation:

5 0
3 years ago
PLEASE ANSWER THIS QUICKLY IF YOU CAN!!!!
IgorC [24]
It’s earthquake area becusse it right by the ocean cause the plates underground to rumble causing a earth quake
8 0
4 years ago
Read 2 more answers
Other questions:
  • Who would be the most appropriate person to consult for nutrition information?​?
    6·2 answers
  • In what ways is the filtrate that enters the glomerular capsule different from the blood? Help please?
    9·1 answer
  • Which of these statements about the afferent division of the nervous system is true?It ascends with sensory information.It desce
    9·1 answer
  • Prokaryotes cells may be found in
    13·2 answers
  • The cells of plants and animals are similar, except for a few different structures. Which structures are only found in plant cel
    15·1 answer
  • Differentiate between parenchyma, collenchyma on the basis of their cell wall.<br> PLS SAY QUICK
    6·1 answer
  • Which of the following is a societal benefit to the application of biotechnology? a. increased crop production b. development of
    6·2 answers
  • Two different species evolving from a common ancestor MOST likely occurs?
    8·2 answers
  • Variation in offspring is important in maintaining genetic diversity within a population. Which of the answer choices indicates
    9·1 answer
  • .
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!