The vinegar had turned the whites of the egg clear, so you can see in it.
Hope this helped :)
Answer:
C Phloem transports glucose to the plant, and stomata release oxygen
Explanation:
A Stomata take in water,sunlight, and carbon dioxide and release oxygen - this is false, the stomata are for gas exchange (taking in carbon dioxide and releasing oxygen). They do not take in water and sunlight
B Phloem transports water, stomata take in carbon dioxide, and chlorophyll absorbs sunlight - this is false, while it is true that stomata take in carbon dioxide, and chlorophyll absorbs sunlight. phloem does not transport water, that is the xylem.
C Phloem transports glucose to the plant, and stomata release oxygen - this is true. Stomata takes in carbon dioxide and releases oxygen, and phloem transport the products of photosynthesis throughout the plant
D Xylem takes in water, sunlight and carbon dioxide and releases oxygen - this is false. Xylem does take in water, but not sunlight, carbon dioxide or oxygen
Double layered nuclear, the outer nuclear membrane is continuous with the membrane of the rough endoplasmic reticulum (ER), it also continues with the inner nuclear membranes since the two layers are fused together at a numerous tiny holes called nuclear pores that perforate the nuclear enevelope
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
An example of secondary pollutant is sulfurage