1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nignag [31]
3 years ago
10

Which traits are characteristic of single-celled organisms?

Biology
1 answer:
omeli [17]3 years ago
4 0
B and C)
They often obtain most of their nutrients through the cell membrane as diffusion is able to take place passively and so at no energy loss to the organism, this can be essential for a single celled organism as they are able to produce a lot less energy due to having fewer mitochondria in comparison to multicellular organisms. 
They also require few resources as single celled organisms are very small and so require only a small amount of raw resources for respiration because they have a small energy demand to meet.
You might be interested in
This organ reabsorbs water and electrolytes, and stores feces
Radda [10]

Answer:

A: Esophagus

Explanation:

Hopefully this helps!

8 0
3 years ago
How are the plants in a desert ecosystem most likely to differ from the plants in a rain forest ecosystem?
erik [133]
Hey,

I believe this answer is A: The desert plants are likely to be better at retaining water.

Which they do, and they have to cause water is very scarce in the desert unlike the rain forest.

Desert plants likely to be larger is not proven and most plants can vary in size.

Narrower stems may have something to do with it but that goes back to they have to hold more water so this is incorrect.

Brighter flowers doesn't have anything to do with water consumption within a plant so this is incorrect as well.

Hope this helps!
Brainliest is always appreciated if you feel its deserved.
 <span />
5 0
3 years ago
Read 2 more answers
Describe the pathway of blood through the kidney
AveGali [126]
Blood<span> flows to the </span>kidneys through<span> the right and left renal arteries. Inside each </span>kidney<span> these branch into smaller arterioles. The </span>blood<span> is at very high pressure and flows </span>through the arterioles into tiny knot of vessels called the <span>Glomerulus.
</span>
:')

6 0
2 years ago
A population decreases after many members emigrated when a nearby river becomes polluted. How would you explain the reason for t
Olenka [21]
Emigrated means they exited so due to the high amounts of pollution all the animals left which cause a population decrease
3 0
3 years ago
Read 2 more answers
Iron reacts with atmospheric oxygen to form iron oxide or ferric oxide. Look at the chemical equation for this reaction:
kondaur [170]

Answer:

4 Fe + 3 O₂ → 2 Fe₂O₃

Explanation:

Let's start with the oxygen.

Reactants - 2

Products - 3

What number do 2 and 3 have in common? 6.

Put a 3 in the reactants and a 2 in the products to balance the oxygen.

Fe + 3 O₂ → 2 Fe₂O₃

Now let's look at the iron.

Reactants - 1

Products - 4

Put a 4 in the reactants to balance the iron.

4 Fe + 3 O₂ → 2 Fe₂O₃

The equation is balanced. Hope that helps.

8 0
3 years ago
Other questions:
  • Which fungi has a positive and negative mating strands
    11·1 answer
  • Why do we need to study, talk and explore the Male and Female Sexual Anatomy
    13·1 answer
  • Help Me With My Science Plz Will Give Brainliest!!!!
    14·1 answer
  • You have learned in class that changing the pH or temperature of the environment can denature an enzyme. When an enzyme is denat
    9·2 answers
  • How are symbiotic bacteria on the roots of some plants called legumes and the nitrogen cycle related?
    8·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What is the most likely reason why Tuj1 was used to assess the phenotype of cells that have incorporated the five candidate gene
    6·1 answer
  • Nitrogen fixing bacteria in soil turns nitrogen gas into
    7·1 answer
  • Required
    11·1 answer
  • 2. Slime moulds cannot be put neither in kingdom Plantae nor in kingdom Animalia. Give reason.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!