1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mezya [45]
3 years ago
10

The upward force exerted on an object falling through air is?

Biology
1 answer:
Paha777 [63]3 years ago
5 0
It is Air resistance.
You might be interested in
Why is the rainfall pattern different on the Mountains of Kohala and Mauna Kea?
NeX [460]
The rainfall pattern is different on the mountains of kohala and mauna kea because of the difference of ranges
4 0
2 years ago
Why is cellulose considered to be complex carbohydrates
Nata [24]

Answer:

Cellulose is considered as complex carbohydrates

Explanation:

It is beacause usually it is found outside of the plant and it is so hard and rigid so it is hard to digest. They are usually used in making colths.

5 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
What is responsible for the decreased stability of rna compared to dna?
Art [367]

The reason why the RNA has decrease stability compared to DNA is because the DNA, is lacking a hydroxyl group in which making it more stable than of the RNA, that is why RNA has decrease stability than the DNA.

4 0
3 years ago
Unlike amphibians, reptiles
OleMash [197]
I'm pretty sure the answer is B
6 0
3 years ago
Other questions:
  • Why is it important that hydrogen bonds are weaker than ionic bonds in DNA?
    11·1 answer
  • Mount St. Helens was a cone-shaped mountain that formed when molten material reached the surface of Earth and formed layers. Con
    7·2 answers
  • 2 examples of gene flow
    7·1 answer
  • Sugar crosses the cell membrane from an area of high concentration to an area of low concentration using
    13·1 answer
  • Why do the sun burn people
    7·2 answers
  • List and describe five examples of declining biodiversity
    11·1 answer
  • How could a change in an abiotic factor such as sunlight affect an ecosystem?
    10·1 answer
  • Each body cell of a goldfish contains 94 chromosomes.
    15·1 answer
  • HELP.. _____ immunity occurs when a person's immune system responds to an<br> antigen.
    11·1 answer
  • I’ll give BRAINLIST??What organs/organs systems does schizophrenia affect and how does it affect it?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!