All categories

3 years ago

What are the characteristics of the genetic code of humans

Biology

1 answer:

andrezito [222]3 years ago

5 0

Answer:

The genetic code has four main features: Three nucleotides/bases encode an amino acid, there are 20 different amino acids which are the building blocks for proteins. The genetic code is non-overlapping

Explanation:

You might be interested in

What happened to the strips of clay as they were pushed from opposite ends?

aleksandrvk [35]

Answer : The strips of clay would get buckled up upwards when pushed from the opposite ends.

As clay is soft material and can be easily molded into different shapes and sizes so it gets bended.

It can be related to the ecological change in the environment for formation of mountains from lithosphere.

5 0

3 years ago

Read 2 more answers

James has been working in the yard all day and has suddenly discovered the muscles in his arms and legs have begun to spasm caus

Lynna [10]

A - James is experiencing heat cramps

3 0

3 years ago

(2) Using the image shown on the slide: How do you think the arctic halocline lavers of

lapo4ka [179]

Can I see the image ...

4 0

3 years ago

What two elements have the same number of energy level (shells)?

melomori [17]

Answer:

Elements that are found in the same horizontal row (belong to the same period) in the periodic table, e.g. Fluorine and Neon both have the same energy level of 2.

<em>Note: The question does not specify any two elements.</em>

Explanation:

The modern periodic table is organized into eight vertical columns known as groups and seven horizontal rows known as periods. The atomic number ( number of protons in the nucleus) of elements increases when moving across the periodic table from left to right. The horizontal rows or periods represents an energy levels or the number of electron shells in an element. Energy levels (also called electron shells) are fixed distances from the nucleus of an atom where electrons may be found. Elements belonging to the same period have the same number of energy level or shells. For example, the elements belonging to Period 2 include lithium, beryllium, boron, carbon, nitrogen, oxygen, fluorine and neon. These all have the same number of energy level of 2.

7 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago