During Meiosis, Cell divides "Twice" (2 times )
Hope this helps!
Answer:
75% would have the dominant traits for coat length, 25% would have recessive trait for coat length.
Explanation:
After completing a punnet square, we could find that our genotypes are 25% LL, 50% Ll, and 25% ll.
If these genotypes were to be physically expressed, LL and Ll would both be expressed as showing the dominant trait.
This means that 75% would have the dominant traits for coat length and 25% would have recessive trait for coat length.
I hope this was helpful! Let me know if you need any clarity.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
<span>Assume: Energy = Sunlight.
grow lamps, etc.
A is definitely correct: Plants and trees that need maximum light MUST be able to grow as tall or taller than the other plants/trees around them. Plants that are more efficient at producing food (through photosynthesis) can live in the shadows of other plants. B doesnt involve getting or using energy. C is the function of food storage. The Energy was used to make the carbohydrates up in the leaves. D This should read New Leaves on the tree... If the tree was not deciduous, the leaves would stay on the tree and continue to perform photosynthesis throughout the year - as long as there was ample light. A is definitely correct and D is probably a correct answer also. FYI - Photosynthesis takes water from the plant, CO2 from the air and Energy from the Sunlight. Chloroplasts (the Green in the green leaves and stems) combine the molecules and light energy to produce 3 byproducts: O2, H2O, and Carbohydrates (mainly sugar or C12H22O11). The carbohydrates are then transported by the plants capillary system (by means of the Phloem which flows down to the roots) to the roots where it is converted as needed to be stored as some form of sugar or starch for use later in plant growth (leaves, stems and roots).</span>
Answer:
The answer is no. Total solar eclipses can happen on other planets too, as long as they have moons that are big enough to cover the sun's disk from the planet's perspective and orbit the planet on the same plane as the sun, astronomers told Live Science.
Explanation:
