1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RideAnS [48]
3 years ago
14

Help me please. . . .

Biology
1 answer:
kodGreya [7K]3 years ago
3 0
Number 1 ,3 and 4 are the answers


good luck
You might be interested in
Dna is made of chains of four smaller molecules called.
lilavasa [31]

Answer:

DNA is made of chains of four smaller molecules called "Nucleotides".

Explanation:

A molecule consisting of a nitrogen-containing base (adenine, guanine, thymine, or cytosine) in DNA is known as a nucleotides.

7 0
2 years ago
Which is an example of population density?
Arisa [49]

Answer:

The example for population density is "two jaguars per thousand hectares"

Explanation:

To known the population size per unit area we use population density. Or sometimes use it for volume. It is expressed in quantity or in the type.  Mostly used for the living organisms, specifically humans. It's unit is expressed in square kilometers or may say in square mile. It is used for country, city, town and another territory. The negative relationship is found to affect the population density. It depends on the reproduction and survival.

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
A diploid species has 2n=52 chromosomes. If you found a monopsony in a member of this species how many chromosomes would you hav
Lerok [7]
26 as 52/2 =26

<span>I hope this helps!</span>
4 0
3 years ago
What kind of signals does the endocrine system send?
anyanavicka [17]
The endocrine system uses chemicals
7 0
3 years ago
Read 2 more answers
Other questions:
  • Where do producers get their energy?
    14·2 answers
  • Simplifid factors plzzzzzz! Help
    8·1 answer
  • This scientist is known for his work with natural selection, and he is known as the Father of Evolution.
    8·1 answer
  • Can I get some help filling the blanks ?? Please?
    5·1 answer
  • The loose skin of the ___________ allows for expansion during erection. corona penile glans penile shaft foreskin
    7·2 answers
  • All living things are made of organic compounds which contain the element:
    10·2 answers
  • Human activity in the Mojave desert impacts the balance of the ecosystem.<br> A. True<br> B. False
    8·2 answers
  • Which of these is a downside of the Endangered Species Act?
    13·1 answer
  • Question 4
    6·1 answer
  • Select the best answer. Which statement is true about all convection currents?(1 point)
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!