1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KatRina [158]
4 years ago
5

How did decades of whale hunting affect whale populations

Biology
1 answer:
Helga [31]4 years ago
6 0

Answer:

In just two decades, the population of bowhead whales in the area had reduced by over 60%. With this decline, it became harder to hunt whales, so whalers also turned their attention to walruses. ... The profits gained from whaling were too great for anyone to take notice of these impacts

Explanation:

You might be interested in
What are Nano-liposomes?How do they work?
noname [10]

A liposome is a spherical vesicle having at least one lipid bilayer. The liposome can be used as a vehicle for administration of nutrients and pharmaceutical drugs. A less desirable form are multi vesicular liposomes in which one vesicle contains one or more smaller vesicles.


3 0
3 years ago
Read 2 more answers
Moderates weather so that highs and lows are less extreme<br><br> I need the factor of that
Yuki888 [10]

The presence of some water body like oceans, seas, or large lake in an area affects the climate such that it moderates the weather so that highs and lows are less extreme.

Climate is a type of weather that remains in an area for a very long-time. A specific kind of weather is the identity of any area and is called climate. In general, the average time period for a climate to remain the same of over 30 years.

Weather is the short term condition of any smaller area that can change at any instant. It can be of different varieties like cloudy, windy, rainy, dry, etc. Th presence of water bodies affects the weather because the water allows a region to cool down to heat up quickly.

To know more about weather, here

brainly.com/question/10049855

#SPJ1

7 0
1 year ago
When an oncologist is teaching about how radiation induces genomic instability, which topic should the oncologist discuss?
Volgvan
He/she is talking about genetic disorders. Interesting topic. An oncologist is a cancer specialist so I don't know the specific cancer disorder but I'm sure there is one.
3 0
4 years ago
In a laboratory experiment with three groups, one group of people drinks pure water, a second group drinks an equal amount of be
ki77a [65]

Answer:

The alcohol group will have produced the greatest volume of urine

The concentrated salt solution group will have produced the least volume of urine

Explanation:

Alcohol inhibits the antidiuretic hormone. This hormone, also known as vasopressin hormone, is released by changes in serum osmolarity or blood volume. Its function is to keep homeostasis and make kidneys conserve or keep water by concentrating urine and by reducing its volume. By these actions, the antidiuretic hormone stimulates water reabsorption, acording to the organism´s needs. The antidiuretic hormone is very sensitive to the presence of alcohol in the blood. Alcohol inhibits the hormone production and the kidneys eliminate more water than the necessary volume. In other words, alcohol is a diuretic substance that enhances urine production.  

Salt ingestion causes an increase in plasmatic osmolarity, stimulates thirst and hence, water ingestion. It also causes an increase in the antidiuretic hormone, which anhances in water reabsorption by the kidneys in its collector tubules. Salt consumption causes a change in osmolarity, which drives to an increase in water reabsorption and an important reduction in urine volume.  

7 0
3 years ago
Which therapeutic measure is used to treat renal failure?
777dan777 [17]
<span>'Peritoneal dialysis' therapeutic measure is used to treat renal failure. When chronic kidney disease progresses to the point where kidneys are no longer able to function, it is called renal disease. To stay alive, people will need to have dialysis treatment called peritoneal dialysis.</span>
5 0
4 years ago
Other questions:
  • According to the results of siegel (1975), decreased pain sensitivity after repeated morphine injections was associated with:
    11·1 answer
  • Smoking and lung cancer is it a correlation or causal
    13·1 answer
  • What is the largest single part of the sharks nervous system?
    5·1 answer
  • Virtually every multicellular organism, including you, goes from a single-celled fertilized egg to a large, multicellular organi
    11·1 answer
  • can someone tell me when we r talking about cells from example diffusion is the movement of molecules from an area of high conce
    11·1 answer
  • The study of organisms in relationship to their environment is what?
    11·2 answers
  • She is puzzled that the clone does not have an effect, even though she knows, based on available mutants, that loss of the funct
    8·1 answer
  • Using the diagram below, how many electrons will Be have if it is a neutral atom?
    8·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Is it easier to restore damaged land and soil than it is to protect true or false
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!