1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
3 years ago
15

What happens when tectonic plates move away from each other?

Biology
1 answer:
Anton [14]3 years ago
4 0
Hello to answer your question fully.

A divergent boundry<span> occurs when two tectonic plates move away from each other.

                Signed by, </span>Frequent Answerer Sargedog
You might be interested in
What is a cardinal? please help
Alecsey [184]
A cardinal can be a red bird found mostly in America and other parts of the world 

Also a Catholic person who is behind the POPE and could become a pope <span />
5 0
3 years ago
How is the process of carbon fixation in CAM plants different from the process in C3 and C4 plants
Genrish500 [490]
One has more atificial growth hormones
6 0
3 years ago
Polka dots are dominant in one eyed monsters while stripes are recessive. If Koa is a purebred dominant and Taya is a purebred
alexandr402 [8]

Answer:

It would be 75%

3 0
3 years ago
The arms of humans and the flippers of dolphins have a similar bone structure. So, they’re _______ organs. The legs of a kangaro
wariber [46]

i believe the correct answers are:

1) B. homologous

2) A. analogous

6 0
3 years ago
Read 2 more answers
◕‿↼ Please Asap, Tysm!
iren2701 [21]

Here's the solution,

<u>1. Condensation</u> :

=》the changing of a gas to a liquid

<u>2</u><u>.</u><u> </u><u>troposphere</u><u> </u><u>:</u>

=》the layer in which weather changes occur

<u>3</u><u>.</u><u> </u><u>Ozonosphere</u><u> </u><u>:</u>

=》layer absorbing ultraviolet rays

<u>4</u><u>.</u><u> </u><u>evaporation</u><u> </u><u>:</u>

=》the changing of liquid to a gas

<u>5</u><u>.</u><u> </u><u>G</u><u>reenhouse</u><u> </u><u>effect</u><u> </u><u>:</u>

=》carbon dioxide and water vapor trapping heat given off by Earth

<u>6</u><u>.</u><u> </u><u>Automobile</u><u> </u><u>:</u>

=》the major source of pollution

<u>7</u><u>.</u><u> </u><u>Ionosphere</u><u> </u><u>:</u>

=》layer responsible for reflecting radio waves

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which characteristic of life best describes the process of photosynthesis
    5·2 answers
  • Why are the products of photosynthesis reaction necessary for life on earth?
    15·1 answer
  • In eukaryotes, there are _______________ codons that specify amino acids. (0.5 pt.)
    6·2 answers
  • What is the purpose of glycolysis? *
    10·2 answers
  • What is the pair of disaccharides
    13·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • A scuba diver went down 20 feet below the surface of the water. Then she drove down 3 more feet. Later, she rose 7 feet. What in
    8·1 answer
  • What do carbohydrates, proteins, and fats have in common?
    9·1 answer
  • I got 2 and 4 wrong on my quiz and failed? These were the same exact questions. I don't know why...
    8·1 answer
  • How dose food chain start
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!