1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nata0808 [166]
2 years ago
13

What is the pair of disaccharides

Biology
1 answer:
Aneli [31]2 years ago
5 0
A disaccharide (also called a double sugar or biose[1]) is the sugar formed when two monosaccharides (simple sugars) are joined. Like monosaccharides, disaccharides are soluble in water. Three common examples are sucrose, lactose,[2] and maltose.         


Disaccharides are formed by the condensation reactions of two simple sugar molecules.

You might be interested in
A location has the conditions stated below. warm ocean water winds to carry air upwards Which of these weather conditions is mos
Galina-37 [17]
D hurricanes makes the most sense because lightning isn't and blizzards have nothing to do with ocean waters and tornadoes only occur inland. 
7 0
2 years ago
Read 2 more answers
What is the purpose of sociology <br>​
irinina [24]

Answer:

Sociology's purpose is understanding how human action and consciousness both shape and are shaped by surrounding cultural and social structures.

:)

7 0
3 years ago
Someone, plz help me!!! I will give 30 points to the correct answer!!!
Stels [109]

Answer: Farming Hunting and Industrialization

Explanation:

3 0
2 years ago
In the experiment determining the parental genotype of plant seedlings from a monohybrid cross, if the dominant color was green
eimsori [14]

Answer:

cc × cc

Explanation:

This question involves a single gene coding for plant seedling. The green allele (C) is dominant over the white allele (c). This means that the green allele will mask the phenotypic expression of the white allele in a heterozygous state (Cc).

In this experiment where plate 1 only contained white seedlings instead of all green, this illustrates that all the offsprings were recessive. This is because the parental genotypes were both recessive for the color trait i.e. cc.

Note that, the recessive trait can only be expressed when the recessive alleles are present in a gene. Therefore, the parental genotype would have been cc × cc, in order to give rise to all offsprings with the recessive trait (white colour).

7 0
2 years ago
90 POINT HELP ASAP!!!!!!!!!!!
-BARSIC- [3]

Answer:

Lungs

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the main role of a hormone?
    11·1 answer
  • A nectar-eating bird has a slightly more curved beak than average for its species. This allows the bird to more easily access ne
    14·1 answer
  • #14.. you can ignore 13 and 15
    7·2 answers
  • After reviewing the results of your science fair project, you state that water has increased the growth of fungi. This is a(n)
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • For the catabolite repression control system, what would be the effect on the phenotype of the lac operon of a regulator protein
    10·1 answer
  • Which shows a correctly paired DNA molecule?
    9·1 answer
  • Natural selection is driven by which of these? *
    11·2 answers
  • Someone pls answer fast
    6·1 answer
  • Drinking non-potable water can cause
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!