Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
They can pass through the semi permeable membrane
Explanation:
The permeability of a particular solute depends on the size, solubility, properties etc and even the properties of the membrane it is aiming to pass through
If molecules are small enough, then they can pass through the semi-permeable membrane. This is as a result of permeability being inversely proportional to the molecule size.
Answer:
B. The hydrogen and oxygen atoms in water share their electrons; sodium transfers an electron to chlorine in sodium chloride.
Explanation:
The bonds between sodium and chloride in NaCl (table salt), and oxygen and hydrogen in water are different as sodium and chloride in NaCl have ionic bond and oxygen and hydrogen in water have the covalent bond.
Sodium transfers an electron to chlorine in sodium chloride (NaCl), so that they both have full outer shell and form ionic bonds. sodium and chloride ions exerts electrostatic force on each other and bond together with ionic bonds.
The hydrogen and oxygen atoms in water have covalent bonds because they are bonded by sharing electrons. Both hydrogen and oxygen atoms share unequal electrons with each other and form V-shaped water molecule.
Hence, the correct answer is "B."
