Answer:
The results from this experiment conclude that all of the resulting bacteria contain the pUC18 plasmid without the human gene.
The method of genetic engineering might seem very easy but in actual it is a very difficult task and most of the time a person won;t get the expected results. The chances of a vector to actually take up a recombinant DNA are very less. Even after this, the chances of a recombinant plasmid to enter a bacterial cell by transformation are very few.
Answer is combination
cccc::::
Body cells are those that are responsible for the formation of tissues and organs, while a gamete is that cell responsible for reproduction.
- Gametes are sex cells, when a male gamete joins a female gamete in the framework of sexual reproduction of plants and animals, a zygote is formed.
- Body cells are any cell in the body that are not gametes, which originate from embryonic stem cells and constitute the totality of the body's tissues and organs of multicellular organisms.
Therefore, we can conclude that body cells are those cells responsible for the growth of organs and tissues and gametes are each of the sex cells that fuse during fertilization.
Learn more about the difference between body cells and gametes here: brainly.com/question/14892337
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
they all die and suffer a horrible unimaginable torture in hell with cats eating them from the eyes then tails then feet then left to bleed out in the name of Jesus
