1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldfiish [28.3K]
4 years ago
5

PLS HELP 30 POINTS! This is about the Hardy-Weinberg equation in biology. If a population has a frequency of q = 0.25, what is t

he frequency of p?
0.05

0.25

0.50

0.75
Biology
2 answers:
LekaFEV [45]4 years ago
7 0
(p+q)^2=1
p=0.75
Right answer is this
ohaa [14]4 years ago
4 0

thanks for the answer it is correct

You might be interested in
What is the difference between an introduced and an invasive species?(1 point)
kaheart [24]

Answer:B, an introduced species is not necessarily harmful to the environment, an invasive species has a negative effect

Explanation:

3 0
3 years ago
Although allergic reactions are triggered by allergens like pollen and fungi, the actual cause of the symptoms like mucous produ
galina1969 [7]
Although allergic reactions are triggered by allergens like pollen and fungi, the actual cause of the symptoms like mucous production and constricted airways is A) the body's immune response. B) the effect of medical treatment. C) the surrounding weather conditions. D) the clogging effect of the allergens. <span>Although allergic reactions are triggered by allergens like pollen and fungi, the actual cause of the symptoms like mucous production and constricted airways is
A)
the body's immune response.
B)
the effect of medical treatment.
C)
the surrounding weather conditions. </span>
7 0
3 years ago
Read 2 more answers
How will a short term environmental change most likely affect organisms within an ecosystem
Sladkaya [172]

Answer:

d. and e. I believe would be the correct answer

4 0
3 years ago
the small size of the phytoplankton gives them the benefit of . It also , which maximizes their ability to absorb nutrients.
Ivan

Answer:phytoplanktons are photosynthestic organism. They have the ability to produce their own food.

Explanation: Because of there small size they could absorb nutrients in the water even at lower concentration and convert it to energy need for there growth.

Its is said that phytoplanktons are one of the largest producer of oxygen gas.

4 0
3 years ago
How does the fact that telomeres are long stretches of repeated nucleotides lessen the impact that somatic cells don’t have te
Cloud [144]

Telomerase activity is controlled during development and is extremely low in somatic (body) cells, virtually undetectable. These somatic cells age because they do not frequently use telomerase.

  • Telomeres are repetitive sections at the very ends of chromosomes that are present in a variety of eukaryotic species, including humans and unicellular protists.
  • Each round of DNA replication wears down a little portion of the telomeres, which serve as caps to safeguard the interior chromosomal regions.
  • Most somatic (body) cells do not typically have telomerase activity, but certain adult stem cells and germ cells—the cells that produce sperm and eggs—have.
  • Adult germ cells, tumor cells, and fetal tissues all contain telomerase. Telomerase activity is controlled during development and is extremely low in somatic (body) cells, virtually undetectable. These somatic cells age because they do not frequently use telomerase.

learn more about telomerase here: brainly.com/question/14213408

#SPJ4

4 0
2 years ago
Other questions:
  • Water is split into what elements ?
    9·1 answer
  • Which gas has a greater potential to harm the atmosphere: methane or carbon dioxide? Use data from the table to explain your ans
    12·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The ability of the pupils to return to normal in low-light conditions is known as __________ .
    6·2 answers
  • In humans, excess blood glucose is stored in the liver and in muscle tissue in the form of glycogen Glycogen is a long chain of
    15·1 answer
  • Why are tapeworms parasites to brine shrimps?
    15·2 answers
  • The princess’s diary is a what source ?
    11·2 answers
  • Which theory directly
    10·1 answer
  • Please help
    6·1 answer
  • Investigation Question: How does air get energy?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!