1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mash [69]
4 years ago
11

DNA contains instructions for making the different molecules that a cell needs to grow and function. For example, _____________

is made by __________________.
A- A protein, translating mRNA
B- mRNA, translating DNA C- A protein, transcribing mRNA
D- mRNA, transcribing proteins
Biology
2 answers:
AlekseyPX4 years ago
8 0
Proteins are made by the translation of mRNA (via tRNA molecules.) This process is essential for everyday life because proteins perform necessary functions. The protein is your end goal, even though to get there you have to first transcribe DNA to mRNA, then translate mRNA.
MA_775_DIABLO [31]4 years ago
3 0

protiens are made by translating mRNA

You might be interested in
How would you state the events of prohase of mitosis?
dsp73

Answer:

prophase would be the stage when the nucleus membrane break to allow the chromosomes to get ready for metaphase.

8 0
3 years ago
2. What is the weight of the same book on Mars where the force of gravity is 3.7 N/kg?
ycow [4]
Is 3.2 bc it says gravity
6 0
4 years ago
What is the combination of alleles that you can see called
blondinia [14]
The combination is the one we see is physical and the author one that we can’t see is unphysical
4 0
3 years ago
265. The perimeter of a rectangle
LenaWriter [7]

Answer:

L = 17 m, W = 12 m

Explanation:

W = (L - 5) m

 

P = 2(L + W) = 58 m

 

Substitute W = L - 5 from the first equation into the second equation and get L:

 

2[L + (L - 5)] = 58

 

2(2L - 5) = 58

 

2L - 5 = 58/2 = 29

 

L = (29 + 5)/2 = 17

 

Then W = L - 5 = 17 - 5 = 12

8 0
3 years ago
What is the difference between a plant cell and animal cell
dem82 [27]
Animal cells don't have cell walls, or chloroplast but plant cells do. Animal cells are round and irregular in shape, while plant cells have fixed rectangular shapes.
7 0
4 years ago
Other questions:
  • Which two organ systems are primarily responsible for the long-distance coordination of body function?
    8·1 answer
  • Which of these hydrocarbons has a double bond in its carbon skeleton?
    14·1 answer
  • Where does digestion start
    7·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • On a weather map, isobars that _____ indicate strong winds.
    13·1 answer
  • Parts of a vacuum flask and their functions
    11·1 answer
  • When water TRANSPIRES from the stoma into the atmosphere, what phase is it in?
    6·1 answer
  • Write two sentences or clues, one for each word, that will help you remember the difference between actin and myosin. (Example:
    5·1 answer
  • Write 2-3 complete sentences to describe the government in United States
    8·1 answer
  • In an organism, the structure and function of parts are related. Function is the task the specific part, while structure is the
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!