1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cloud [144]
3 years ago
11

In traditional recombinant DNA technology, a desirable gene from one organism is inserted into the DNA of a host organism. Howev

er, to create a synthetic life form, Craig Venter’s team actually builds the entire DNA molecule from individual DNA nucleotides. Why would it be harder to create a synthetic life form than to use recombinant DNA technology
Biology
1 answer:
Diano4ka-milaya [45]3 years ago
3 0

Answer:

The correct answer is "In order to create a synthetic life form it would be necessary to know the function of every gene and include them in the organism".

Explanation:

The most common approach of studies using recombinant DNA technology is to insert a desirable gene from one organism into a host organism. This approach is much more feasible that creating a synthetic life form because, in order to create a synthetic life form, it would be necessary to know the function of every gene and include them in the organism. Even though the whole DNA sequence of many organisms is known (including humans), the function of the entire sequences of the genome is yet to be understood.

You might be interested in
Grass is the first member of the ocean food web.
HACTEHA [7]

Answer:

Phytoplankton and algae form the bases of aquatic food webs. They are eaten by primary consumers like zooplankton, small fish, and crustaceans. Primary consumers are in turn eaten by fish, small sharks, corals, and baleen whales.

Explanation:

6 0
3 years ago
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
Which of the following can best generate repulsion between adjacent molecules or parts of molecules?a. Hydrogen bonds b. Electro
melomori [17]
D. Hydrophobic interactions
5 0
3 years ago
The pedigree shows the inheritance of an autosomal recessive disorder. What is the genotype of Steve and Sonya's son?
FromTheMoon [43]

Answer:

The answer is pp

Explanation:

Steve and Sonya's son genotype is pp. Because an inheritance of autosomal recessive disorder  is with recessive allele responsible for the exceptional phenotype. In this case, Steve and Sonya are both heterozygotes, Pp, which means they both have a p allele  because each one gave the boy a p, contributing to affect his son. And since we are talking about inheritance of an autosomal disorder, we know that the parents phenotypic proportions are the same.

8 0
3 years ago
The act of breathing raises the blood oxygen levels, lowers the blood carbon dioxide concentration, and raises the blood pH. Acc
Alexus [3.1K]

C. a rise in blood carbon dioxide concentration

Explanation:

Negative feed back mechanism refers to the control mechanism in which a product of a particular pathway controls the switch on and switch off of that particular pathway.

Since breathing increases the blood oxygen concentration and lowers carbon dioxide concentration and pH. The sensors that regulate the breathing should respond to oxygen concentration as the carbon dioxide is the by-product of respiration and is responsible for increasing blood pH. Thus  increased Carbon dioxide levels in blood is the only factor which will trigger breathing.

5 0
3 years ago
Other questions:
  • "to improve cardiovascular fitness, _____ workout sessions per week are optimal"
    9·1 answer
  • The elevation of the metabolic rate that occurs after ingestion of a meal is
    15·1 answer
  • which organic compounds would be the best to analyze in order to determine if two species are closely related?
    7·1 answer
  • If we can’t see air, can fish see water ?
    6·2 answers
  • The carbon containing molecules can then be used
    11·1 answer
  • A chemical imbalance in the blood can cause the heart to stop pumping blood, which in turn will cause other tissues and organs t
    7·2 answers
  • Anything that elicits an immune response is called a
    15·1 answer
  • As the moon revolves around Earth, the moon
    8·1 answer
  • when paleontologists dated the Burgess shale fossils to the Cambrian period because trilobites were found among them, were they
    5·1 answer
  • Organisms depend on , which are compounds that stabilize ph by absorbing or releasing h ions.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!