1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
9

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
miss Akunina [59]3 years ago
4 0
A because like what even is this??
You might be interested in
When more than one operon is under the control of a single regulatory protein, the operons are collectively called a(n) When mor
fomenos

Answer:

Regulon

Explanation:

A regulon comprises of a group of operons that are controlled by the same regulatory protein referred to as a regulator which could act as a repressor or activator.

Regulons in bacterial cells are referred to as the fundamental unit of the response system. Regulons are majorly used when referring to prokaryotes that have their genome organized to operons, although this term is not limited to that. The genes that are found in a regulon are arranged into two or more operons at different regions on the chromosome.

7 0
3 years ago
I need help explaining why my evidence supports my claim (picture above)
joja [24]

Answer:

  1. My evidence is important to my claim because it demonstrates the vitality of both non-elemental and conductive elements and their contributes to enhancing the very essence of human proliferation. More importantly my evidence is indicative of our reliance to natural resources and the importance of protecting the sustainability of said resources.
7 0
3 years ago
. What makes a TEM useful for examining structures inside cells?
Tasya [4]

Answer:

big pp BIG PP small pp :(

3 0
3 years ago
In a praticular breed of cattle, a black coat is dominant over a red coat. If a cow with a red coat is crossed with a black bull
steposvetlana [31]
You are correct :) Red coat's genotype would be tt and the black bull's genotype would be Tt. You put those in a punnett square, and you'd get 2 tt's and 2 Tt's. Hope this helps! :D
6 0
3 years ago
A mom, heterozygous for type B blood, has a baby with type AB blood, what possible blood types could the baby's father have?
EastWind [94]

Answer:

A

AB

Explanation:

This question involves blood type, which can either be blood type A, B, AB or O in humans. Alleles A (iA) and B (iB) are co-dominant but dominant over allele O (i).

According to this question, a mom who is heterozygous for type B blood i.e. genotype iBi, has a baby with type AB blood. Since the mother contributed the "B" allele, it means that the father contributed the A allele. Only a father with genotype: iAi or iAiA (type A) or iAiB (type AB) can produce such allele.

4 0
3 years ago
Other questions:
  • Why do stem cells have the potential to<br> cure many human diseases?
    11·1 answer
  • During osmosis Group of answer choices pure solvent and a solution both diffuse at the same time through a membrane.
    10·1 answer
  • 1.List 2 examples of positive feedback loop in you body
    10·2 answers
  • "A woman who is having her third baby planned to have an epidural analgesia for her labor and birth. However her labor was so ra
    8·1 answer
  • Approximately how far apart were north america and europe 200,000 years ago
    6·1 answer
  • What characteristics of DNA results in cell differentiation in developing embryos?
    10·1 answer
  • Hey so I need help with this for my IXL
    7·1 answer
  • 5. The process involving the transfer of molten material from one place in the earth's crust to
    10·1 answer
  • Cho trâu đực đen 1 giao phối với trâu cái đen 2. Năm đầu sinh được nghé đen 3 và năm sau sinh được nghé xám 4.
    10·1 answer
  • Name and describe the division of gymnosperms.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!