1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
9

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
miss Akunina [59]3 years ago
4 0
A because like what even is this??
You might be interested in
Which of the following describes the grains found in igneous rocks?
Ira Lisetskai [31]
D. All 3..................................
5 0
3 years ago
Scientists have a great deal of responsibility. Why is it important for scientists to communicate their results accurately to pe
Scrat [10]
Because everything scientists do or see is put out where the whole world can see. But if they don’t do it accurately then they get proved wrong or even lose their job. And the more accurate an answer is the more opportunity they have to venture and see more Han what they already know.
3 0
4 years ago
What do ribosomes need ​
Ugo [173]
Ribosomes are the protein synthesizers and build protein
4 0
4 years ago
Please select the word from the list that best fits the definition Use an outline to answer your questions
neonofarm [45]

Answer: the answer is write

Explanation:

4 0
3 years ago
Read 2 more answers
Mrs. smith underwent an arthrodesis of her spine for spinal deformity, posterior approach, segments l3-l5. what procedure code i
arlik [135]
<span>The reported procedure code is 22800 since spinal arthrodesis is coded based on the approach. If an instrument was used, this would also be coded for the procedure. </span>
3 0
3 years ago
Other questions:
  • How organisms do the process of cellular respiration
    10·1 answer
  • Genetic material in order from simplest to most complex.
    13·1 answer
  • How do you know if a trait on a pedigree is recessive?
    5·1 answer
  • A phylogenetic tree constructed using sequence differences in mitochondrial DNA would be most valid for discerning the evolution
    7·1 answer
  • Which is a basic characteristic of all living cells?
    15·2 answers
  • Chomosomes are duplicated during
    13·2 answers
  • A, I need help on a short science quiz! Very soon, please...
    10·2 answers
  • HELP ME ASAP<br> PLEASE HELP
    10·1 answer
  • the climactic crash between the britian and france for the control of the north american conteinet spang their rivarly for contr
    14·1 answer
  • Bulbils are means of vegetative propogation?​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!