1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
9

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
miss Akunina [59]3 years ago
4 0
A because like what even is this??
You might be interested in
The Earth is about _______ years old, and life has existed on Earth for about _______ years.
Naya [18.7K]

Answer:

is about 4.6 billion years old

8 0
3 years ago
Provide THREE reasons why Nguni cows are referred to as excellent mothers ​
Goshia [24]

Answer:

They have long productive lives, cows will produce 10 or more calves calving regularly. The cows show great efficiency and often wean calves that weigh 45-50% of their body mass

3 0
3 years ago
Read 2 more answers
What can lead to coral bleaching?
Ira Lisetskai [31]

I’m not sure but I think is the answer C
3 0
3 years ago
Read 2 more answers
Select one:
AfilCa [17]
I think the answer is d not quite sure tho
8 0
3 years ago
How are frogs adapted for terrestrial life?
shusha [124]
Frogs are amphibians, which means they need to live in both water and land.

They are adapted to hop on land with their feet, and their tongue to eat.

The reason frogs have lungs and also breathe through skin is so they can breathe in both of their habitats
3 0
3 years ago
Other questions:
  • a scientist plans to cut a segment of DNA so that it can be inserted into the DNA of a bacterium, a single celled organism. This
    8·1 answer
  • Which of these statements best proves that oceans cause climate change by transferring water from one place to another?
    11·2 answers
  • Which mineral is commonly found in the three metamorphic rocks slate, schist and gneiss
    15·1 answer
  • The antibiotic penicillin is isolated from
    15·1 answer
  • What is the main role of the lungs? <br> In your own words please
    11·2 answers
  • How do mutations lead to genetic diversity?
    8·1 answer
  • Which of the following is the reason that kelp live in deep, calm waters?
    5·1 answer
  • Explain how sexual reproduction produces variation.​
    10·1 answer
  • Which parts of a plant or animal contain the genetic information for characteristics like this?
    7·1 answer
  • Most of the joints in the appendicular skeleton are __________ joints.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!