1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
9

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
miss Akunina [59]3 years ago
4 0
A because like what even is this??
You might be interested in
What do solid and hazardous wastes have in common?
jonny [76]

Answer:

Hazardous and solid wastes can be solid, liquid and gaseous form.

Explanation:

Hazardous wastes are wastes that are composed of harmful or toxic substances which is generated from industries, households, hospital e.t.c that are threat to humans and their environment.

Solid wastes are discharged or absconded materials such as refuse, sludge, gabbage, from water treatments, air pollution, household, industries e.t.c.

5 0
3 years ago
- What structures appear in<br>the nucleus shortly before<br>cell division?​
Setler [38]

Answer:

chromosomes

Explanation:

4 0
3 years ago
Why is the ability of the cell membrane to be "picky" important?
Yuliya22 [10]

Answer:

Hi there!

Your answer is:

It is very important for the cell membrane to be <em>semi-permeable</em> because the ability to pick and choose what comes in and out of the cell keeps the cell safe! The membrane can choose to block out nasty germs and can also choose to get rid of internal waste.

An example of when this is important is in this scenario:

Let's say the cells are in a really salty solution. Naturally, salt will want to pull the water out of the cell. If the membrane <u>wasn't</u><u> </u> semi permeable, the water would listen to the salt and leave the cell. This would cause cell death. <u>BECAU</u><u>SE</u> the membrane is semi permeable, they can choose <em>not</em> to give the salt any water, keeping them alive

Hope this helps

5 0
3 years ago
Fill in the blank<br><br> DNA IS NOT “TURNED ON” ALL OF THE _____ IN ALL OF THE CELLS.
AlexFokin [52]

Answer:

time? maybe I'm not to sure but I wanted to help

6 0
3 years ago
Salmonberry leaf cells contain 14 chromosomes. How many chromosomes will a new leaf cell contain after mitosis ?
Mama L [17]
The new leaf will contain 14 chromosomes, because during mitosis, a cell makes an exact copy of itself. Therefore, the number of the chromosomes in that cell stay the same.
7 0
4 years ago
Read 2 more answers
Other questions:
  • What is the structural covering of a jellyfish?
    15·1 answer
  • What structures are found in the small intestine to aid with absorption?
    9·1 answer
  • The lipopolysaccharides are found in the Choose one: A. inner membrane. B. periplasm. C. cytoplasm. D. outer membrane.
    6·1 answer
  • Is Exothermic/Endothermic related to Product/Reactant Favored?
    6·1 answer
  • You're conducting an experiment to determine the effect of different wavelengths of light on the absorption of carbon dioxide as
    6·1 answer
  • A mother is unsure who the father is of her newborn. Before doing DNA analysis, a simple blood test is performed to give some pr
    5·2 answers
  • Selectively cutting down trees on an area of land can be best described as ?
    5·1 answer
  • How is cancer related to mutations? How is it related to the cell cycle?
    10·2 answers
  • How is biodiversity related to the biosphere?
    14·1 answer
  • Explain why people with emphysema suffer from shortness of breath​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!