1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
9

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
miss Akunina [59]3 years ago
4 0
A because like what even is this??
You might be interested in
Although fats are an important component of a healthy diet, overconsumption of some types of fats may cause heart disease. Which
love history [14]
B unsaturated fats like olive oil and pine nuts are the healthy fats
6 0
3 years ago
Read 2 more answers
How can a mutation led to variation
Vikki [24]
Mutations produce random changes in an organism's genetic code. Mutations can occur in non-reproductive cells and then they will not be passed to the next generation, therefore will not contribute to variation. Only mutations that occur in reproductive cells are passed on to the next generations and contribute to genetic variation in a population.

3 0
3 years ago
Read 2 more answers
The study of the function of specific organ systems is called
mart [117]

Answer:

Systemic Physiology

Explanation:

8 0
2 years ago
2. What is the water used for in the light reactions of photosynthesis?
riadik2000 [5.3K]

Answer:

water provides the electron that binds the hydrogen atom (of a water molecule) to the carbon (of carbon dioxide) to give sugar (glucose). Water acts as a reducing agent by providing H+ ions that convert NADP to NADPH

4 0
3 years ago
Read 2 more answers
What determines the order of elements in today's periodic table??
Sindrei [870]

Answer: the atomic number (number of protons) order the elements.

Explanation: Each element on the Periodic Table has their own configuration of electrons. In order to have a neutral charge, there is an equal number of protons to electrons. Thus, the atomic number (number of protons) order the elements.

4 0
3 years ago
Other questions:
  • A. lactic acid fermentation
    10·1 answer
  • Which type of selection on a polygenic trait increases variation in the trait
    8·1 answer
  • Neptune is smaller than the gas giants and Earth. True False
    7·2 answers
  • what is an important principle of the scientific method in which an experiment can accurately be reproduced by an independent re
    11·1 answer
  • Why is anaerobic respiration considered less efficient than aerobic respiration? A Less energy is required during anaerobic resp
    15·2 answers
  • What will you do to observe Earth Day?
    7·1 answer
  • Cellular respiration in the mitochondria releases energy by breaking down A: food molecules B: water C: carbon dioxide D: ATP
    14·1 answer
  • 5. What is Virus ? Explain.<br>वाइरस क्या है ? समझाइए।​
    10·1 answer
  • Digestive bacteria and humans - Human beings have what is often called "good" bacteria in
    6·2 answers
  • Can someone please help me with this. I really need help it’s due tonight
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!