1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
9

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
miss Akunina [59]3 years ago
4 0
A because like what even is this??
You might be interested in
Which of the following sequences represent the complementary DNA sequence to the DNA strand — AGATCCGTA —?
Leokris [45]
Answer :TCTAGGCAT it’s C
7 0
2 years ago
Photosynthesis is a process in which plants prepare food using carbon dioxide, chlorophyll, and water in the presence of sunligh
Sholpan [36]
The answers are solar for the first one, and chemical for the second one
7 0
3 years ago
Read 2 more answers
State the identities of the substrate , enzyme and product involves .
tester [92]
<span>Enzymes are Biological Catalysts. They increase the rate of Metabolic reactions. Almost all Biological Reactions involve Enzymes. All enzymes are Globular Proteins with a specific Tertiary Shape. They are usually specific to only one reaction.</span><span>The part of the Enzyme that acts a Catalyst is called the Active Site. The rest of the Enzyme is much larger and is involved in maintaining the specific shape of of the Enzyme.</span><span>When a reaction involving an Enzyme occurs, a Substrate is turned into a Product. The Substrate can be one or more molecules. The Active Site of an Enzyme is Complementary to the Substrate it catalyses.</span>
6 0
3 years ago
Why are individuals with HIV able to contract diseases that are rare to the rest of the population?
Serhud [2]
People with HIV are unable to fight off these rare diseases because they have a weakened immune system.
5 0
3 years ago
Read 2 more answers
Name three things NGOs are doing to help preserve tropical rain forests
HACTEHA [7]

Answer:

How to Save the Rainforest

Teach others about the importance of theenvironment and how they can help save rainforests.

Restore damaged ecosystems by planting trees on land where forests have been cut down.

Encourage people to live in a way that doesn't hurt the environment.

Establish parks to protect rainforests and wildlife.

8 0
3 years ago
Other questions:
  • 2 Summarize how the Ti plasmid is used to<br> insert genes into plant cells.
    14·1 answer
  • A study indicates that fertilizers from nearby farm fields have entered a lake. Which of the following describes a likely change
    14·2 answers
  • Reproductive isolation caused by a river is an example of
    9·1 answer
  • Titanium, a very strong the durable mineral, is used to making bikes, automobile parts, and sports equipment
    10·1 answer
  • Which characteristics are always present in all living organisms? -Movement -Heredity -Reproduction -Homeostasis -Sensitivity -M
    15·1 answer
  • What's the role of the complement in the phagocytosis?
    8·1 answer
  • Why do parents and offspring often appear similar?
    14·1 answer
  • Please help me out with this
    12·1 answer
  • What is the best replacement for the underlined word in the sentence below: The glucose in fruit can help give you energy. a. Vi
    8·1 answer
  • During which life stage does a caterpillar create its chrysalis?.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!