1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
2 years ago
9

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
miss Akunina [59]2 years ago
4 0
A because like what even is this??
You might be interested in
What is the role of b cells in the human immune system
Natasha_Volkova [10]
B cells mature in the bone marrow, which is at the core of most bones It recognises invaders by the shape of molecules -antigens- on their surfaces. With the help of T cells, B cells make proteins called antibodies. The antibodies will help your body become aware of intruders.
4 0
3 years ago
Which structures that distinguish a eukaryotic cell from a prokaryotic cell are part of the internal membrane system?
Nat2105 [25]

Answer:

nuclear membrane, endoplasmic reticulum, Golgi apparatus, and vesicle

Explanation:

The structures or organelles in internal membrane system in the cell do all production, processing and secretion function together. A prokaryotic cell does not contain any membrane bound organelles but Eukaryotic cells do have. Nuclear membrane has double membrane and golgi-rendoplasmic reticulum and vesicle contain single membrane so all these organelles are membrane bounded.

4 0
3 years ago
Read 2 more answers
The moisture from when a plant is in a closed container
Olegator [25]
The answer to this question is Condensation
5 0
2 years ago
Which of the following is NOT a function of the skeletal system?
Elina [12.6K]

Answer:

communication is not the function of skeletal system

3 0
2 years ago
Read 2 more answers
Help please :,))) AHHHHH
STatiana [176]

Answer:

Anerobic Respiration

Explanation:

this is the answer Anerobic Respiration

6 0
2 years ago
Other questions:
  • A mother with normal color vision and a color blind father have a color blind daughter. Which statement is true a. All daughters
    8·2 answers
  • What dose homeostasis
    15·1 answer
  • When sunlight excites electrons in chlorophyll how does the electrons change?
    15·1 answer
  • A man is exposed to large amounts of ultra Violet radiation while sunbathing at the beach. This exposure causes a genetic change
    12·1 answer
  • How thick is the exosphere?
    7·1 answer
  • Society expects scientists to follow ethical practices and meet many ethical standards. Which is an example of one of these ethi
    14·2 answers
  • The properties of an unknown element are listed below.
    14·1 answer
  • What happens to the DNA helix when a cell reproduces?
    9·1 answer
  • how do you describe the shape of each sample of matter? do the ice cubes have a definite shape? how about the water? how about t
    13·1 answer
  • Define homeostatasis in your own words
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!