1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
9

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
miss Akunina [59]3 years ago
4 0
A because like what even is this??
You might be interested in
What is the human genome project?
gogolik [260]

Answer:

The Human Genome Project was an international scientific research project with the goal of determining the base pairs that make up human DNA, and of identifying and mapping all of the genes of the human genome from both a physical and a functional standpoint

3 0
3 years ago
Read 2 more answers
The presence of two peripheral efferent neurons in a pathway is typical of the ________ division.
Svetllana [295]
The presence of two peripheral efferent neurons in a pathway is typical of the autonomic division. The autonomic division is part of the vertebrate nervous system and this system is responsible for involuntary action regulation (regulation of the intestines, heart, and <span>glands).

</span>
8 0
3 years ago
From which part of the plant do we obtain from<br><br> 1. Hemp<br> ____________________
boyakko [2]

Answer:

Their roots take up water and minerals from the ground and their leaves absorb a gas called carbon dioxide (CO2) from the air. They convert these ingredients into food by using energy from sunlight. This process is called photosynthesis, which means 'making out of light'. The foods are called glucose and starch.

Explanation:

5 0
2 years ago
(a). the reaction, to produce soap can be completed by cooking animal fat with a very strong solution of
Gemiola [76]
The reaction to produce soap can be completed by cooking animal fat with a very strong solution of SODIUM HYDROXIDE.
This process is called saponification. Chemically, animal fat and strong solution of sodium hydroxide or potassium hydroxide mixed together to produce soap and glycerol.<span />
4 0
3 years ago
3)
lisabon 2012 [21]

Answer:

A) climate change...........

4 0
3 years ago
Other questions:
  • The heart, liver, and stomach are each examples of
    11·1 answer
  • Describe what happens during prophase I and metaphase I and how these phases play an important role in the genetic diversity of
    6·1 answer
  • The nervous tissue is found in brain, spinal cord, and peripheral nerves <br> a. True <br> b. False
    9·1 answer
  • The relationship between hemoglobin ____________ and po₂ is shown by an oxyhemoglobin dissociation curve.
    8·2 answers
  • Some species of jellyfish use jet propulsion to get around. True or False
    11·2 answers
  • I need help because i dont really know how to do this
    11·2 answers
  • The biotechnological processes used by two geneticists are described below.
    11·2 answers
  • What unit of measurement do you use to measure mass
    13·2 answers
  • Which of the following is a true statement cellular respirstion occurs only in plant cells cellular respirstion occurs only on a
    15·1 answer
  • 7<br><br><br> help!<br><br><br> ------------
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!