1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
9

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
miss Akunina [59]3 years ago
4 0
A because like what even is this??
You might be interested in
What happens when a person who is allergic to ragweed encounters ragweed?
slava [35]
Ragweed antigens bind ragweed and then bind mast cells which release histamine 

<span>Allergies develop because of a Th2 response against the allergen. </span>

5 0
3 years ago
Discuss 3 different types of mutations that can happen
Brums [2.3K]

Answer:

Explanation:

Un cambio en la secuencia de bases en el ADN o ARN se conoce como mutación . ¿La palabra mutación te hace pensar en ciencia ficción y monstruos con ojos de insecto? Piensa de nuevo. Todos tienen mutaciones. De hecho, la mayoría de las personas tienen decenas o hasta cientos de mutaciones en su ADN. Las mutaciones son esenciales para que ocurra la evolución. Son la fuente principal de todo el material genético nuevo -nuevos alelos - en una especie. Aunque la mayoría de las mutaciones no tienen efectos en los organismos en que ocurren, algunas mutaciones son beneficiosas. Incluso las mutaciones dañinas rara vez causan cambios drásticos en los organismos.

4 0
2 years ago
Read 2 more answers
The<br>is the basic unit of life.<br>A. organism<br>B. cell<br>C. tissue<br>D. organelle​
kicyunya [14]

Explanation:

The cell is the basic unit of life

5 0
3 years ago
Read 2 more answers
Question 3 (1 point)
Annette [7]

Answer:

  1. Ask a question.
  2. Form a hypothesis
  3. Perform experiment
  4. Analyze data

Explanation:

Hopes this helps :)

4 0
3 years ago
if retinal detachment occurs in the macula or fovea, one can predict that there would be a significant loss of ______.
eimsori [14]

Answer:

color vision

Explanation:

7 0
2 years ago
Other questions:
  • Thalidomide and l-dopa, shown below, are examples of pharmaceutical drugs that occur as enantiomers, or molecules that _____.
    8·1 answer
  • What is the most endangered shark species
    14·1 answer
  • Matter is needed to transfer thermal energy by
    14·1 answer
  • How is being a groomer related to agriculture
    15·1 answer
  • An atom of lithium (Li) forms an ionic bond with an atom of chlorine (Cl) to form lithium chloride. How are the valence electron
    7·2 answers
  • What is a gene pool?
    15·1 answer
  • If you continue operating the tractor at its current level, how many acres can you expect to fertilize in the next hour?
    12·1 answer
  • What term describes the blood<br> pressure when the heart is at rest?
    9·2 answers
  • Cephalization, the clustering of neurons and interneurons in the anterior part of the animal, is apparent in I) mammals II) cnid
    13·1 answer
  • imagine that you have crossed two types of peonies, one with purple flowers and long stems, and the other with white flowers and
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!