1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
9

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
miss Akunina [59]3 years ago
4 0
A because like what even is this??
You might be interested in
The surgical repair of a vessel is _____.
umka2103 [35]
I believe it’s angioplasty. 95% sure. Good luck
5 0
3 years ago
The nitrogenous base adenine can pair with, what?
svlad2 [7]
The nitrogenous base that pairs with Adenine is Thymine.
5 0
3 years ago
Read 2 more answers
Improved functional health can be a positive influence on which health risk/
Valentin [98]
<span>An improved functional health can have a positive influence on physical inactivity for this is a modifiable risk factor.  The prevalence of improve functional health is higher than physical inactivity compare to other risk factors because this will encourage an individual to have a physical activity such as biking, swimming or any routine physical fitness. </span>
4 0
3 years ago
Bones are connected to each other by:
romanna [79]
They are connected by tendons
4 0
3 years ago
Read 2 more answers
During which stage does a cell experience growth and chromosome replication?
statuscvo [17]
S phase for mitosis. so yea
7 0
3 years ago
Other questions:
  • Richard is an avid gardener who spends a lot of time caring for the plants in his garden. To minimize damage from pests from his
    9·1 answer
  • The majority of exchange of gases and nutrients between blood and tissue takes place at the _______ level A. capillary bed B. sm
    14·1 answer
  • Dramatic biological changes, caused by a cascade of different hormones, that occurs during adolescence is referred to as what?
    7·1 answer
  • What is the job of Mrna
    7·1 answer
  • Boards of pharmacy regulate pharmacists
    7·2 answers
  • Attraction of magnets is caused by similar poles aligning .<br> true or false ?
    5·1 answer
  • The data of this lab
    7·1 answer
  • All living things are made up of building blocks known as ______.
    5·2 answers
  • Knowing that greenhouse gases are contributing to climate change, how can we
    7·2 answers
  • What was the initial human impact on the wolf population
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!