1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
2 years ago
9

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
miss Akunina [59]2 years ago
4 0
A because like what even is this??
You might be interested in
The gradual decline in men's testosterone levels in middle age can reduce their _____.
Phantasy [73]
The gradual decline in men's testosterone levels in middle age can reduce their sex drive
3 0
3 years ago
Energy pyramids show how energy is ________________ at each food chain level
andreyandreev [35.5K]
Distributed through time or 
along the line
5 0
2 years ago
Which of the following best describes how a chemical reaction will proceed with an enzyme compared to without the enzyme?
Verdich [7]
<span>With an enzyme, the activation energy of the reaction decreases, which increases the reaction rate. 
</span>
8 0
2 years ago
Read 2 more answers
What led to the Dust Bowl?
Contact [7]

Answer:B

Explanation:

6 0
2 years ago
Read 2 more answers
Help please asap
vovangra [49]

Answer:

a. Directional selection favors one end of the phenotype distribution, whereas

stabilizing selection favors intermediate over extreme phenotypes

Explanation:

Directional selection is called directional because it favors one phenotype over another, and stabilizing selection finds a balance between phenotypes.

7 0
2 years ago
Other questions:
  • Which of the following conditions favors "big-bang" reproduction?a. high rate of offspring survivalb. intense inraspecific compe
    12·1 answer
  • Scientists want to determine how closely related chimpanzees are to humans. Which data would give the MOST accurate comparison?
    7·2 answers
  • A 1-month-old infant in the neonatal intensive care unit is dying. his parents request that a nurse give the infant an opioid an
    13·1 answer
  • What is the color of water?
    14·1 answer
  • Which of the following correctly compares how plant and animal cells differ?
    6·1 answer
  • 1. Explain why you chose the two-word names for each organism.​
    9·1 answer
  • The chromosomal mutation in the zygote can be traced back to which of the following? (4.3, 4.4)Immersive Reader
    15·1 answer
  • The table shows the percentage of different colors of rats in a population that survive to reproduce.
    8·2 answers
  • Which process occurs when liquid water becomes water vapor
    6·1 answer
  • Why are cockroaches considered parasites to human?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!