1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Grace [21]
3 years ago
13

The process of making rna from dna

Biology
1 answer:
Rama09 [41]3 years ago
3 0

DNA transcription

hope this helps :)

You might be interested in
Why is carbon the backbone of liveing things
Lyrx [107]
Because of its ability to form large complex and diverse molecules
3 0
3 years ago
Which ties to the Calvin cycle because it gives photosynthesis a pathway of light reactions and dark reactions.
vovangra [49]

Answer:

What is the link between the light reactions and the Calvin cycle during photosynthesis?

Light-dependent reactions, which take place in the thylakoid membrane, use light energy to make ATP and NADPH. The Calvin cycle, which takes place in the stroma, uses energy derived from these compounds to make GA3P from CO2

3 0
3 years ago
Nucleic acids are polymers. What is the repeating monomeric unit that composes the polymer?
Papessa [141]

Answer:

Explanation:.

6 0
3 years ago
Why you need to know the accompaniments of salad and dressing?​
Ket [755]

Answer:

You need to make sure the dressing is in a good place, because once its on the salad, it cannot hold really well. Well that really depends on the dressing. More liquidy dressings will make your salad soggier faster. So to help with this, you can add herbs, vegies, meat, even some fruit to help soak up the dressing a bit.

Explanation:

I'm not a 100% sure but I hope this helps.

5 0
3 years ago
On which bone does Styloid Process occurs?
ehidna [41]

Answer:

the styloid process is located rt.above or superior to the sternum.

of the chest, between the rib cage.

Explanation:

it is actually located rt. above the sternum.

7 0
3 years ago
Other questions:
  • Which statement is best supported by the X-rays?
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What are areas of dna that are not needed to produce a protein called?
    11·1 answer
  • Is a superficial fungal infection found on the head.
    8·1 answer
  • Typically best practices would dictate that a guest account would be placed in a(n) __________, isolated from the production net
    14·1 answer
  • Which statements accurately describe the Doppler effect? Select three options.
    11·2 answers
  • What substance in the esophagus lining helps make swallowing easier?
    6·1 answer
  • Name and describe the process which involves the iris controlling the amount of light entering the eye when a person is exposed
    9·1 answer
  • Please help<br>me find the answer<br>​
    12·1 answer
  • Prokaryotic organisms/cells have which of the following characteristics?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!