1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergiy2304 [10]
3 years ago
5

Why do you think it is an advantage for pigs to have long uterine horns and a small uterine body, and not the opposite?

Biology
1 answer:
stellarik [79]3 years ago
7 0
The answer is so they can have large litters. This then would be an advantage for the pigs to have the long uterine horns and also a minute uterine body and also not the opposite. Hope this is the answer and would be of help.
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
This forms after fertilization and is made up of a plant embryo.
Daniel [21]
That is answer is A
8 0
2 years ago
What protective measures should you take during a direct action recovery?
Sladkaya [172]

The protective measure is to inform the recovery team of the location of other hostages. It is not true that during that time you get a weapon and assist the recovery team because it may be so dangerous for you and also the team’s life. Also in recovery there must be a establish communication procedure such as signaling this is he aid in recovery.

6 0
3 years ago
Why can algae and cyanobacteria be considered indicators of productivity as well as of pollution
Gelneren [198K]

Algae and Cyanobacteria could mean life is flourishing and is a good food source for some fish in moderation- but if there's a lot of fertilizer runoff, they can grow too quickly and be counterproductive for the environment

6 0
3 years ago
Read 2 more answers
Modern fishing practices threaten biodiversity mainly through the _______.
FinnZ [79.3K]
I think the correct answer from the choices listed above is option D. Modern fishing practices threaten biodiversity mainly through the removal of community food supplies. When people remove a significant amount of fish, portions of the food web are disturbed and can affect a certain ecosystem.
7 0
3 years ago
Other questions:
  • What is the most famous piece of art in the prado museum
    10·1 answer
  • One year is the amount of time it takes Earth to ______.
    5·2 answers
  • Which glands are located on the front and sides of the trachea just below the larynx?
    12·1 answer
  • A newly pregnant woman is trying to choose a health care provider for her pregnancy and birth. she desires to have the health ca
    11·1 answer
  • Which population dispersion pattern is most commonly seen in the field for most species?
    5·1 answer
  • In rabbits long hair is recessive to short hair. Determine the genotype and phenotype ratios of the offspring produced by a cros
    9·2 answers
  • which if the following is responsible for adding nitrogenous bases to the DNA template during replication?
    8·1 answer
  • Which of the following is NOT a function of lipids?
    7·2 answers
  • Where does compression often occur?
    14·1 answer
  • A negative ion made of oxygen and hydrogen
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!