1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maslowich
3 years ago
15

Which of the following is true about the usage of public land? a. All public land is managed by the Bureau of Land Management (B

LM). b. Only federally owned public land is considered protected. c. Public land can be protected or unprotected. d. State parks are considered unprotected public land.
Biology
2 answers:
Neporo4naja [7]3 years ago
6 0

the answer to this question is C

alekssr [168]3 years ago
5 0
<span>The correct answer should be C. Public land can be protected and unprotected. This means that it even though things belong to the public they can either be protected by for example military and have forbidden access to people, or they can be unprotected and people can freely visit and do what they want as long as it's not destruction of property in any way.</span>
You might be interested in
(iii) Humans have four types of teeth. State which type of tooth mainly in (a) (ii) above.​
11111nata11111 [884]

Answer:

The correct answer is - molars.

Explanation:

Mechanical digestion takes place inside the mouth of an organism by the process called masticating with the help of teeth. There are four types of teeth in the mouth all help in the digestion of the feed incisor cuts the food, canines tear the food, premolars, and molars chew or masticate the food.

The main and major tooth that helps in mechanical digestion is the molar to chew food so it can mix with the saliva to make bolus and chemical digestion.

4 0
3 years ago
What cell structures are both not found in maple leaf cell and an elephants cell
Lera25 [3.4K]

The answer is cell wall!!!XD


Hope this helped!!!XD

7 0
3 years ago
How does thiobacillus denitrificans help bioremediate groundwater
borishaifa [10]
Hello.

The answer is D<span>enitrification.

</span>Denitrification is  <span>nitrogen or nitrogen compounds added or taken away.

It helps becasue there is e</span>xcess nitrate and puts nitrogen in the everment.

Denitrification also helps the ground water.

Have a nice day
7 0
4 years ago
Which of the following ideas is supported by Darwin's observations of local variation among tortoises in the Galapagos islands?
poizon [28]
B adaption because galapagos islands the is like no food
7 0
3 years ago
Read 2 more answers
In 1-2 sentences, describe what a sequence-tagged site (STS) is and how STSs are used in genome sequencing.
Ede4ka [16]

Answer:

STS are short stretches of DNA used for producing genomic map

Explanation:

Sequence tagged sites (STS) are primers that possess some form of sequence knowledge and are used to produce genetic maps through standard mapping procedure. STS primers are short replica or stretch of DNA which is detected by using PCR array.

These STS primers are unique and sequence specific and thus are responsible for detecting variations in genomic DNA and can also distinguish between homozygotes and heterozygotes.  

3 0
4 years ago
Other questions:
  • Does decay always happen at the same rate in ecosystems?
    7·2 answers
  • Help ya girl? i dont really get this
    11·2 answers
  • In the Cori cycle, when glucose is degraded by glycolysis to lactate in muscle, the lactate is excreted into the blood and retur
    8·1 answer
  • How do animals get the carbon atoms to form the CO2 molecules that they exhale ?
    8·1 answer
  • Vampire squid (Vampyroteuthisinfernalis) are deep-sea cephalopods with features similar to both octopus and squid. Extensive vid
    15·1 answer
  • Where is DNA found? A. vacuole B. chromosomes C. cell membranes D. Golgi body
    15·2 answers
  • Four substances are important for both photosynthesis and cellular respiration: oxygen, glucose, carbon dioxide, and water. What
    14·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • What is the approximate percentage of total fixed nitrogen attributed to human activities?
    8·1 answer
  • Which animals appear most prominently in the diver scene from the tomb of the hunting and fishing?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!