1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRa [10]
3 years ago
5

*ANSWER ASAP TY*

Biology
2 answers:
malfutka [58]3 years ago
8 0

Answer:

The correct answer is <em>c.) plants that produce flowers that resemble money</em>

Explanation:

Cash crops resemble money from flowers or other vegetation in fields. People sell their crops to get money, so this is why it is called a cash crop.

Hope this helped! :)

Ivahew [28]3 years ago
8 0
The correct answer would be D! Cash crops are usually cheap crops that are widely used and grow quickly. Hence the name, cash crops are cheap and make quite a bit of money. Hope this helps!
You might be interested in
The following statements refer to a comparison of reproduction in ferns vs. flowering plants. Indicate whether each statement is
Dennis_Churaev [7]

Answer:

Both ferns and flowering plants produce spores at some point in their life cycles. True

Only ferns have a gametophyte as part of their life cycle. False.

Only flowering plants produce pollen grains. true

Both a tree and a large fern plant are diploid sporophytes. True

Explanation:

Yes, both ferns and flowering plants produce spores in their life cycles. In fern plant, it produce spores on the underside of the leaves whereas in flowering plant, there are two types of spores such as microspores and megaspores. Both ferns and flowering plants have gametophyte as part of their life cycle. Flowering plants produce pollen grains whereas non-flowering plants produce spores to continue their generation. Both tree and large fern plants having diploid sporophytes which is a necessary part of their life cycle.

7 0
3 years ago
Your classmate has indicated that she wants to experiment with growing tomatoes hydroponically. She is planning to grow the plan
goblinko [34]

The hydroponic method involves growing the tomatoes in a nutrient solution which contains all of the essential elements.

The practise of growing plants without the need for soil is known as hydroponics. Flowers, herbs, and vegetables grown hydroponically are planted in inert growing material and are then given nutrient-rich solutions, oxygen, and water throughout the growing process. The use of this technique results in accelerated growth increased yields, and improved quality. When a plant is growing in soil, the roots of the plant are always looking for the nutrients it needs to survive in order to provide for the plant's needs. If the root system of a plant is provided with direct access to water and nutrients, the plant does not need to expend any energy in order to maintain its own life. It is possible to focus the energy that the plant's roots would have spent obtaining food and water toward the growth of the plant instead. As a direct consequence of this, the development of new leaves and the blossoming of fruits and flowers are both stimulated.

Learn more about hydroponics here :

brainly.com/question/14662027

#SPJ4

7 0
2 years ago
2 UNIS<br> If scientists want to solve an environmental problem, they are most likely to<br> use
Sauron [17]
Use environmental data from air, soil water,food and other materials for scientific analysis
3 0
3 years ago
Proteins provide a lot of functions for your body. Choose a function of proteins
Nikolay [14]
The answer is C build muscle hair and nails
3 0
3 years ago
I need the ANSWER ASAP!!!!!!!!!!Which statement describes what will most likely occur when warm air cools and the temperature dr
larisa86 [58]

Answer:

C C C C C Cccccccccccccccccccccc

8 0
3 years ago
Read 2 more answers
Other questions:
  • What happens during crossing over? Homologous chromosomes trade pieces of DNA. Sister chromatids form tetrads and line up random
    7·2 answers
  • A nurse withholds a prescribed opioid medication from a client with intractable pain because the nurse fears the client will bec
    10·1 answer
  • Which one of the following statements about ribosomes is true?
    14·1 answer
  • A complex molecule containing the genetic code
    14·1 answer
  • A niche is part of an organism's habitat.<br><br> True or False?
    8·2 answers
  • A bird is flying over a field. What will most likely happen if a toxin causes the
    8·1 answer
  • Looks like mitosis metephase
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Please hurry I need this fast
    13·1 answer
  • In T-ball, batters hit a ball that is placed on a T-shaped stand. Batter A hits the ball by swinging the bat from a resting posi
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!