What role do calcium and atp play in muscle contraction?

2 answers:

7 0

It plays a role in nerve conduction, constriction and relaxation of blood vessels, and hormone secretion. Calcium also plays a vital role in muscle contraction, including your cardiac and skeletal muscles.
I HOPE THIS HELPS plz vote me brainliest

nalin [4]3 years ago

3 0

Calcium ions bind to troponin-tropomyosin molecules located on the grooves of the actin filaments. upon binding with calcium ions, troponin changes shapes and moves tropomyosin out of the groove which the tropomyosin normally blocks the actin myosin binding points. This facilitates creation of the myosin-actin crossbridges which are the basis of contraction of muscles. ATP is the form of energy required to facilitate the creation of cross bridges and movement of calcium ions

You might be interested in

What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT

Kazeer [188]

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.

8 0

2 years ago

Read 2 more answers

A biologist at World University used Procedure IV to conduct an additional study and found the sequence following below. Using y

Nady [450]

Answer:

Valine-Leucine-Proline-Lysine-Histidine

Explanation:

The central dogma of biology is the process by which DNA is used to synthesize RNA and subsequently amino acid sequence (PROTEIN). The processes of transcription and translation is used in gene expression. Transcription is the process whereby the information encoded in a DNA molecule is used to synthesize a mRNA molecule. Transcription is catalyzed by RNA polymerase enzyme, which uses complementary base pairing rule i.e Adenine(A)-Thymine(T), Guanine(G)-Cytosine(C) pairing.

N.B: Thymine is replaced by Uracil in the mRNA

For the above DNA sequence: CAC GAC GGA TTC GTA, the mRNA sequence will be: GUG CUG CCU AAG CAU

Translation is the second process of gene expression which involves the synthesis of an amino acid sequence from an mRNA molecule. The mRNA is read in a group of three nucleotides called CODON. Each codon specifies an amino acid (see attached image for genetic code)

Based on the attached genetic code, an mRNA sequence: GUG CUG CCU AAG CAU will encode an amino acid sequence: Valine(Val) - Leucine (Leu) -Proline (Pro) -Lysine (Lys) - Histidine (His).

GUG specifies Valine amino acid

CUG specifies Leucine amino acid

CCU specifies Proline amino acid

AAG specifies Lysine amino acid

CAU specifies Histidine amino acid

5 0

3 years ago

The outer hair cells respond to sound by slightly tilting and changing length. because of the consequence of this, the action of

serg [7]

Basilar membranes

In an active cochlea, basilar membranes vibrate more strongly than in a dead cochlea. because all of the outer hair cells slant significantly and alter in length in response to sound. In response to basilar membrane changes, outer hair cells swell and contract. The frequency tuning curve is impacted by damage to the outer hair cells.

<h3>What are the function of Basilar membranes?</h3>

The basilar membrane is the inner ear's primary mechanical component. Over its length, it has graded mass and stiffness characteristics, and its vibration patterns separate incoming sound into its component frequencies, which trigger various cochlear areas.

Impact do outer hair cells have on our hearing :

As a nonlinear amplifier that enables the cochlea to detect sounds with great sensitivity and accuracy, outer hair cells (OHCs) play a crucial role in hearing. These distortion products can be monitored as distortion-product otoacoustic emissions as a result of the nonlinear sound processing (DPOAEs)

To learn more about Basilar membranes visit:

brainly.com/question/28074500

#SPJ4

5 0

1 year ago

The most species diversity is found in the _____.

murzikaleks [220]

Rain forest contains more species

4 0

2 years ago

How does the length of the small intestine assist digestion?

vampirchik [111]