1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slamgirl [31]
3 years ago
14

When two genes from two different people are sequenced and aligned, it is discovered that there are multiple sequence difference

s in the coding segment DNA level. However, when the proteins formed by the genes have their amino acids sequenced, there is no difference observed between the two. What is the most likely explanation for this observation
Biology
1 answer:
ikadub [295]3 years ago
7 0

Answer:

On the basis of the phenomenon of the degeneracy of codons, the coding of single amino acid can take place by various codons like four different codons, that is, CCC, CCU, CCG and CCA can code for single amino acid proline.  

In case, if there is a mutation in DNA, due to which CCA get transformed to CCG, even in such case coding for the same amino acid proline will take place. Hence, one can conclude that at the level of DNA mutation is taking place, however, the same is not getting witnessed in a protein, and that is why such kind of mutations are termed as silent mutation.  

You might be interested in
__________are inpatient treatment facilities that focus on the "resocialization" of the individual and use the program's entire
andriy [413]

Answer is a. therapeutic communities.

Therapeutic communities are a common form of long-term residential treatment for substance use disorders. These communities provide drug-free environments in which people with addictive problems live together in an organized and structured manner to promote change toward recovery and re-socialization. Some such groups evolved into self-supporting and democratically run residences to support abstinence and recovery from drug use.

8 0
4 years ago
Read 2 more answers
Nutria, Myocastor coypus, are large, semi-aquatic rodents native to South America. They were originally introduced in the US in
Kruka [31]

The characteristics of the nutria include of those here EXCEPT that "nutria can only live in freshwater marshes in coastal areas along the Gulf  Coast".

<u>Option: D</u>

<u>Explanation:</u>

Nutria survives not only in freshwater marshes but also in wetlands, and can respond to various environments reasonably easily. In aquatic habitats, the species flourish and migrate rapidly across rivers into coastal wetlands. Nutria harm prone ecosystems can be seen in many ways.

Beyond destroying plants and crops, nutria kills the channels of ditches, streams, and other water bodies. Even so, the irreversible harm that nutria can do to marshes and other wetlands is of utmost importance.  Nutria in these places rely on native plants which hold together wetland soil. This vegetation's degradation exacerbated the depletion of coastal marshes caused by sea level rise.

5 0
3 years ago
Read 2 more answers
What are two tools that doctors and genetic councilors use to predict genetic disorders?
Pani-rosa [81]
Today doctors use tools<span> such as amniocentesis and karyotypes to help detect </span>genetic disorder<span>.</span>
7 0
3 years ago
Edit: Nevermind! I figured it out!!
Montano1993 [528]

Answer:

meteorite 1- 2.6 billion

meteorite 2- 5.2 billion

meteorite 3- 3.9 billion

5 0
3 years ago
Read 2 more answers
Based on the concept of phylogeny, an organism that was ancestral to both the bacteria and eukaryota domains would exhibit which
Helen [10]
"It would have DNA." is the one among the following characteristics that would be exhibited based <span>on the concept of phylogeny, an organism that was ancestral to both the bacteria and eukaryota domains. The correct option among all the options that are given in the question is the third option or option "C". </span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • Mendel experimented with garden peas. One of the traits he looked at was texture of the pea coat. If we said the pea coat was sm
    15·1 answer
  • Elements are arranged in the periodic table based on various patterns. For example, elements found in the rows near the top
    10·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • What type of orngansizm does photosynthesis and celular respiration occur in
    14·1 answer
  • Give reason for : the plants with falling leaves can do the transpiration process in
    14·1 answer
  • An original DNA strand has the following base sequence: TAGGTAACT What base sequence would be produced through transcription
    5·1 answer
  • Questlon 2 of 10
    9·1 answer
  • Is this statement True or False?
    10·1 answer
  • How could the US conserve and preserve energy resources?
    9·2 answers
  • In addition to cortisol, other hormones that are usually released during many kinds of stress include ______.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!