n a scientific experiment, the factor that may change in response to the manipulated variable is called the ______ variable.

2 answers:

8 0

I believe the answer is Responding or Dependent variable.
Let's say that a study is conducted in order to find out whether Drug A could work in slowing down the growth of Cancer Cells.
In this case, Drug A is considered as Independent variable and Growth of the Cancer Cells is considered as Dependent Variable.

faust18 [17]3 years ago

6 0

The answer is responding.

You might be interested in

Which organelle is not found in an animal cell?

Sergeeva-Olga [200]

Answer:

Cell wall, Vacule, Plastids

Explanation:

3 0

3 years ago

Which types of mutation are possible thanks to the redundant nature of the genetic code?

krok68 [10]

Cancer is a type of harmful mutation.

3 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

In DNA, different alleles of a gene have a different sequence of ___________________. Alleles may have a different sequence of _

Leona [35]

Answer:

blood cotton dna

Explanation:

hahahahahaahahahaha

6 0

3 years ago

I would like this before 11:59 PM EST on Friday, March 26th 2021. Yes, this IS for a HOMEWORK assignment, so PLEASE DON'T DELETE

lapo4ka [179]

Answer:

Minerals can form in all geological environments, which allows them to have a wide range of chemical and physical conditions. Two forms of this are temperature and pressure. There are 4 main categories of mineral formations. Igneous is where the minerals crystalize from a melt. Sedimentary is where the raw materials of the mineral are particles from other rocks that have suffered from erosion and weathering. Metamorphic is where new minerals are created from earlier ones owing to the effects of change. Most of the time it's from increasing temperature and/or pressure. Hydrothermal is where the minerals are chemically precipitated from hot solutions in the earth.

7 0

3 years ago