1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna007 [38]
3 years ago
13

If you drop food coloring into a pitcher of water, and wait a while, what will happen to the molecules of food coloring in the p

itcher?
Biology
1 answer:
Andru [333]3 years ago
4 0
They will break up and disperse
You might be interested in
What types of organisms do you think would not need camouflage as an adaptation
tiny-mole [99]
Decomposes would be considered as a type of organism that wouldn't need camouflage as an adaptation due to not being preyed upon and their energy sources being dead remains or waste.
3 0
3 years ago
WILL GIVE BRAINIEST!!!!!
sammy [17]

Answer : Option 1.) Increased algal blooms and damage to drinking water


6 0
4 years ago
Oxygen is attached to _______.
user100 [1]

Answer: The answer is C. An iron atom located on the heme portion hemoglobin

Explanation: Hemoglobin is responsible for the transportation of oxygen in the red blood cells to tissues of vertebrates. It is the protein molecule found in the red blood cells.

Hemoglobin is made up of 4 heme molecules surrounding the globin group, forming a tetrahedral structure. The heme molecules contain one atom of iron each and this is the binding spot for each molecule of oxygen through a covalent bond. Therefore, each hemoglobin molecule can have up to four molecules of oxygen attached to them.

3 0
4 years ago
One of the armored virus infection techniques utilizes encryption to make virus code more difficult to detect, in addition to se
natka813 [3]

Answer:

The correct answer is - Swiss cheese technique.

Explanation:

The Swiss cheese technique is computer program in which viruses code are created to more encrypted so that they can go undetectable. In this technique, virus inject themselves in to a program throughout the program instead of end of the file.

It inject itself in the host file and overwrite original code and transferred to the virus code for proper execution after the infection.

Thus, the correct answer is - Swiss cheese.

4 0
4 years ago
Name ALL the alleles that control human blood groups.​
Naily [24]

Human blood groups are governed by three alleles. These are called I A ; I B ; I O .

I B shows the codominance

I O is recessive to both other alleles

8 0
2 years ago
Other questions:
  • Kaleb has extensively resistant tuberculosis (tb). treatment for extensively resistant tb would include
    5·1 answer
  • How does size affect the movement of materials across the cell membrane relate to an organismś survival?
    11·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Please help quickly!!!!thanks
    14·1 answer
  • which of the following is the correct path that water takes once it enters a plant. A. Leaves,stems and roots. B. Roots,leaves,s
    6·1 answer
  • Would you expect the population of white peppered moths to increase, decrease, or stay the same during the period of Industrial
    11·2 answers
  • Which of the following statements best distinguishes a hypothesis from a theory?
    8·1 answer
  • What makes lipids different from other organic compounds? A. They make simple sugars. B. They are made of amino acids. C. They c
    6·1 answer
  • What enzyme deficiency in RBC leads to hemolytic anemia due to oxidative stress? ​
    5·1 answer
  • Discuss three contributing factors that led to the human trafficking​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!