Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
The Principle of <u>segregation</u> states that the 2 alleles present at each gene locus separate from one another during gamete formation and remain distinct.
What is principle of segregation?
According to the principle of segregation theory, every human has two alleles for each specific feature and functions, and these alleles separate throughout the development of gametes. In other words, in everycase, each gamete contains a single allele.
Therefore, The Principle of <u>segregation</u> states that the 2 alleles present at each gene locus separate from one another during gamete formation and remain distinct.
To learn more about principle of segregation
Here: brainly.com/question/2161501
#SPJ4
Since the air is a great thermal isolator, the windows prevent heat exchange better than one made out of a single thick sheet of glass. The air between the thin blankets is not moving around and will form an isolating layer that acts exactly like another blanket, thus improving the thermal isolation