1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maru [420]
3 years ago
13

A see me shqpe can be round or wrinkled. What is the seed shape?o

Biology
1 answer:
fredd [130]3 years ago
6 0

Answer:Seed shape is an important trait in plant identification and classification. In addition it has agronomic importance because it reflects genetic, physiological, and ecological components and affects yield, quality, and market price.  Seed shape is determined by a variety of indexes (circularity, roundness, and index).

You might be interested in
Analysis of the second swab has confirmed that the causative organism is Streptococcus pyogenes, a gram-positive organism. Imagi
Ierofanga [76]

Answer:

Purple, spherical-shaped organisms arranged in chain like formations.

Explanation:

Bacteria are the microscopic organisms and included in the prokaryotes as they do not have nucleus. Two main types of bacteria are gram positive bacteria and gram negative bacteria.

The gram positive bacteria has thick cell wall peptidoglycan cell layer and can uptake the crystal voilet stain. These bacteria seems purple under the microscope due to the uptake of stain. The bacteria Streptococcus pyogenes are spherical in shape and occurs in the cluster of chain.

Thus, the correct answer is option (d).

7 0
3 years ago
Read 2 more answers
Which criterion is not used to describe a mass movement event?
Ede4ka [16]

Answer: The angle of the slope

3 0
2 years ago
How do stars have light
VMariaS [17]

Answer:

Our sun is extremly hot. like our sun, hydrogen is being converted into helium, a process which gives off energy that heats the star

Explanation:

7 0
3 years ago
Define adult stem cells. Explain the pros and cons of Adult Stem Cells
WARRIOR [948]

Answer:

hi hope this helped you

3 0
3 years ago
The use of electronic instruments or other techniques to monitor and change subconscious activities, many of which are regulated
Wewaii [24]

The use of electronic instruments or other techniques to monitor and change subconscious activities, many of which are regulated by the autonomic nervous system, is called biofeedback.

<h3>What is biofeedback?</h3>

A mind-body approach known as biofeedback employs a variety of monitoring tools to give the body's physical functions, which are typically controlled by the body's automatic systems, conscious control. There are several kinds of biofeedback instruments that can be used to track the development of the activity and show the efficacy of the therapy as it is being administered.

The equipment that measures the following uses biofeedback the most frequently:

  • brain activity
  • respiration rate
  • blood pressure
  • heartbeat frequency and heartbeat variability
  • tension in muscles
  • electrification of the skin
  • skin temperature

Devices used to measure body change are:

  1. Electromyogram (EMG): To measure muscular tension, use this.
  2. Electrodermal activity (EDA): This measures variations in perspiration rate.
  3. Measures of finger pulses: These evaluate heart rate and blood pressure.
  4. Electroencephalogram (EEG): This is used to assess brain electrical activity.

Learn more about biofeedback here:

brainly.com/question/2837002

#SPJ4

7 0
2 years ago
Read 2 more answers
Other questions:
  • What are the steps in the experiment? (list four steps) How do the scientists test the hypothesis?​
    6·1 answer
  • What is the difference between food chains and food webs?
    6·2 answers
  • What statements is true of sex linked inherited diseases such as hemophilia
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • A hormone is an organ that secretes chemical substances into the bloodstream. Please select the best answer from the choices pro
    10·2 answers
  • Where are haploid cells found?
    15·2 answers
  • When two liquids have the same osmotic pressure they're said to be
    5·2 answers
  • I need the answer ASAP
    11·2 answers
  • Why do we need to study the beginning of life?​
    13·2 answers
  • How would decreasing the amount of water in blood affect blood pressure
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!