To convert 0.0701 kilograms to milligrams, we must first figure out how many milligrams are in 1 kilogram.
1 kg (kilograms) = 1,000,000 mg (milligrams).
Since we have 0.0701 kg, we need to multiply 1,000,000 by 0.0701.
1,000,000 x 0.0701 = 70,100.
There are 70,100 mg in 0.0701 kg.
I hope this helps!
Answer: 307.5 cm.
To convert millimeters to centimeters, divide by 10.
The worm feeds via a "pumping" action in which it first uptakes the fluid surrounding it. Then, it expels the fluid while trapping any bacteria within it. The bacteria are then digested for energy and nutrients.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
The products are H2O and CO2 which then become the reactants for photosynthesis
