1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bonufazy [111]
4 years ago
5

Is a snake a consumer

Biology
1 answer:
MrRissso [65]4 years ago
7 0
Yes, a snake is a consumer.
You might be interested in
Which of the following is something almost everyone can do to reduce his or
leva [86]
The correct answer is letter A
5 0
3 years ago
How do scientific research impact scientific thought ?
creativ13 [48]

Answer:

Until the past decade, scientists, research institutions, and government agencies relied solely on a system of self-regulation based on shared ethical principles and generally accepted research practices to ensure integrity in the research process. Among the very basic principles that guide scientists, as well as many other scholars, are those expressed as respect for the integrity of knowledge, collegiality, honesty, objectivity, and openness. These principles are at work in the fundamental elements of the scientific method, such as formulating a hypothesis, designing an experiment to test the hypothesis, and collecting and interpreting data. In addition, more particular principles characteristic of specific scientific disciplines influence the methods of observation; the acquisition, storage, management, and sharing of data; the communication of scientific knowledge and information; and the training of younger scientists.1 How these principles are applied varies considerably among the several scientific disciplines, different research orgrecently, a few research institutions have developed guidelines for the conduct of reserch

4 0
3 years ago
What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer
Fittoniya [83]
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
8 0
4 years ago
Blank layers of blank make up the cell membrane
sattari [20]

Answer:

Two layers of Lipids make up the cell membrane

Explanation:

The inner and outer phospholipid layers

3 0
1 year ago
Melissa is studying a Gram-stained slide of curd bacteria. She sees many rod-shaped, violet-colored bacteria.What type of bacter
Serhud [2]

The answer is Paramecium.

The paramecium is a unicellular ciliated protozoan. They are often found in fresh water and brackish water areas. They have the elongated shaped that looks like a rod and has the color violet under the stain because it signifies that it is positive.

4 0
3 years ago
Other questions:
  • The picture shows a fishing technique called trawling. How might trawling affect marine biodiversity
    5·2 answers
  • Hypothesis that states that the continents were once one large mass that broke apart?
    6·2 answers
  • How might an object feel that absorbs light?
    5·2 answers
  • Check all statements that are true about nuclear radiation.
    10·1 answer
  • Fifteen grams of a liquid plastic are frozen in a physical change that increases the volume. What can be known about the plastic
    9·2 answers
  • Complete hydrolysis of a glycerophospholipid yields glycerol, two fatty acids (16:1(∆9) and 16:0), phosphoric acid, and serine i
    9·1 answer
  • ____ attack foreign blood that does not contain the same antigens.
    12·2 answers
  • The hepatic portal vein normally contains relatively high levels of which of these? (Select all that apply)
    12·1 answer
  • Which biome contains large populations of grazing herbivores, few species of birds, and deep, rich soil?
    6·1 answer
  • HUMERO - DELTOIDES - COSTILLAS – TIBIA – CODO – BICEPS – ADUCTOR – MUÑECA – CUBITO – PECTORAL – CADERA – GEMELOS– VERTEBRAS – CL
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!