1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
prohojiy [21]
3 years ago
11

PLEASE HELP MEH!!!!

Biology
1 answer:
Lorico [155]3 years ago
6 0
30 g molecular concrete
You might be interested in
Select the pituitary hormone that increases the concentration of blood sugar A. cortisol B. growth hormone C. glucagon AND. epin
marissa [1.9K]
The tragus is a small pointed eminence of the external ear, situated in front of the concha, and projecting backward over the meatus. It also is the name of hair growing at the entrance of the ear.
7 0
2 years ago
Which human action has not lead to significant changes in Earth’s biomes?
valina [46]
The burial practices of humans have not led to any significant changes in Earth's biome. Matter can not be created nor destroyed. Burial practices lead to burying the dead bodies into the Earth, where they are decayed by the action of several microbes and insects. The organic and inorganic compounds are added to the Earth. 
6 0
4 years ago
What do high energy particles do to the atmosphere ? please help quickly !
Bezzdna [24]

Answer:  high-energy primary cosmic-ray particles interact with air nuclei high in the atmosphere, initiating a cascade of secondary interactions that ultimately yield a shower of electrons, and photons that reach ground level.

Explanation:

6 0
3 years ago
Se coincidera que un virus es un ser vivo
katen-ka-za [31]

Answer:

This means:

It will be agreed that a virus is a living being.

Explanation:

Hope I helped ya.

You can give da other girl brainliest.

<u><em>< Sarah ></em></u>

6 0
3 years ago
A student decides to set up an experiment to see if detergent affects the growth of seeds. He sets up 10 seed pots. 5 of the see
Trava [24]

Answer:

The correct answer is option C) "More than one variable is being tested".

Explanation:

One of the basis of scientific experimentation is to test one variable at the time in order to make sure that the response that is being obtained is the result of that variable and not another one that is not taking into account. In this case, the student is making the mistake of assessing two variables at the same time: the use of detergent and placing the plant in the sun or in the shade. At the end of the experiment the student will not know if the response is the effect of the detergent, the exposure to the sun or a combination of both.

8 0
3 years ago
Read 2 more answers
Other questions:
  • The syndrome called ____________ is characterized by confusion, disturbed concentration, and cognitive dysfunction. it has a sud
    6·1 answer
  • Ginger is a modified stem called a rhizome. New shoots can form from a rhizome, allowing the plant to undergo a period of dorman
    11·1 answer
  • Describing the Big Bang Theory
    6·1 answer
  • Four children of a man and woman who are second cousins have too few teeth, which is an autosomal recessive condition called oli
    14·1 answer
  • Match each kind of scientist with an aspect of the hot spring she or he might
    9·1 answer
  • In the oceans on either side of the Isthmus of Panama are 30 species of snapping shrimp, 15 species on the Pacific side and 15 d
    7·1 answer
  • Bruce Wallace (1963) established a laboratory population in which the recessive allele lt was at a frequency of 0.5. He propagat
    10·1 answer
  • 3. Which is not a true statement about the evidence to support
    5·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • __________ acts on groups of paired muscles. When one muscle contracts, the opposite muscle cannot contract because no stimulus
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!