1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NikAS [45]
4 years ago
12

Describe three ways that drugs affect synapses that use the neurotransmitter dopamine

Biology
1 answer:
Keith_Richards [23]4 years ago
5 0
The three ways in which drugs affect the synapses include; they affect the number of neurotransmitters available, the rate of release of neurotransmitters, and binding affinity of neurotransmitter receptors to the neurotransmitters.  For example; Drugs can affect the production of neurotransmitters, movement of neurotransmitters into vesicles, or movement of vesicles to a synapse.
You might be interested in
Which sensations result from activation of interoceptors?
svetlana [45]
Pain is one example of a sensation
4 0
4 years ago
What do Colombians and many others clear the el rainforest for<br> Ñ
Leto [7]

Answer:Cattle ranching is the leading cause of deforestation in the Amazon rainforest

Explanation:Colombia, as a signatory to the New York Declaration on Forests, aimed by 2020 to halve natural forest loss and by 2030 to reach net-zero deforestation, meaning that any loss of forest will be offset by the replanting of native forest.

6 0
3 years ago
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
Reika [66]

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

3 0
4 years ago
What are good sources of unsaturated fats?
Marrrta [24]

Answer:

Saturated Fats, Here are 10 high-fat super foods that are actually incredibly healthy and nutritious.

Explanation:

1. Avocados:

Avocados are a fruit, with fat at 77% of calories. They are an excellent source of potassium and fiber, and have been shown to have major benefits for cardiovascular

2. Cheese:

Cheese is incredibly nutritious, and a single slice contains a similar amount of nutrients as a glass of milk. It is a great source of vitamins, minerals, quality proteins and healthy fats.

3. Dark Chocolate:

Dark chocolate is high in fat, but loaded with nutrients and antioxidants. It is very effective at improving cardiovascular health.

4. Whole Eggs:

Whole eggs are among the most nutrient dense foods on the planet. Despite being high in fat and cholesterol, they are incredibly nutritious and healthy.

5. Fatty Fish:

Fatty fish like salmon is loaded with important nutrients, especially omega-3 fatty acids. Eating fatty fish is linked to improved health, and reduced risk of all sorts of diseases.

6. Nuts:

Nuts are loaded with healthy fats, protein, vitamin E and magnesium, and are among the best sources of plant-based protein. Studies show that nuts have many health benefits.

7. Chia Seeds:

Chia seeds are very high in healthy fats, especially an omega-3 fatty acid called ALA. They are also loaded with fiber and minerals, and have numerous health benefits.

8. Extra Virgin Olive Oil:

Extra virgin olive oil has many powerful health benefits, and is incredibly effective at improving cardiovascular health.

9. Coconuts and Coconut Oil:

Coconuts are very high in medium-chain fatty acids, which are metabolized differently than other fats. They can reduce appetite, increase fat burning and provide

10. Full-Fat Yogurt:

Real, full-fat yogurt is incredibly healthy.

It has all the same important nutrients as other high-fat dairy products.

But it’s also loaded with healthy, probiotic bacteria, that can have powerful effects on your health.

Studies show that yogurt can lead to major improvements in digestive health, and may even help fight heart disease and obesity.

Unfortunately, many of the yogurts found on store shelves are low in fat, but loaded with added sugar instead.

It is best to avoid those like the plague.

4 0
3 years ago
FORENSIC SCIENCE!
Mademuasel [1]

Answer: the carpet padding

Explanation:

Individual evidences are simply refered to as properties of physical evidence that has to a high degree of certainty for a common source. For individual evidences, the suspect is being narrowed down to a single individual. Examples include fingerprints, toolmarks etc.

In the question above, the example of individual evidence when it comes to carpet will be the carpet padding. While other options such as fiber length, dye composition and the type of fiber can still relate to other things, carpet padding narrows it down to carpet.

7 0
3 years ago
Other questions:
  • In Indian cuisine, sometimes a papaya is added to make meat cook faster. Why does this method work?
    10·1 answer
  • The point at which two chromatids are attached to each other in a chromosome is called a(n)
    7·1 answer
  • Compare and contrast the structure of a compound light microscope and a dissecting microscope
    12·1 answer
  • Can you help me with question # 18
    5·1 answer
  • The doubling time of a type of bacteria is 43 minutes. If every bacterium reproduces, then after 43 minutes a population of 1024
    6·1 answer
  • A ramp is an example of an inclined plane. A man in a wheelchair was trying to get up the ramp, but he was having trouble becaus
    9·1 answer
  • Whenever a body is in motion, there is always ____ to oppose the motion.
    11·1 answer
  • What effect does penicillin have on bacterial diseases?
    9·1 answer
  • Which protein serves as a chemical messenger?
    9·2 answers
  • You are exploring a rather inhospitable planet, which has seas that are somewhat hydrophobic in nature. Surprisingly, there are
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!