1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
likoan [24]
3 years ago
7

. The greenhouse effect is the natural warming of Earth's

Biology
2 answers:
Sedbober [7]3 years ago
7 0

Answer:

lower atmosphere and surface

Explanation:

crimeas [40]3 years ago
5 0

The greenhouse effect is the natural warming of Earth's lower atmosphere and surface.

<u>Explanation:</u>

The idea of climate and temperature around the Earth begins with the sun. Approximately 30% of the sunlight reflects back to the cloud and ice from the surface.

The basic rise of the greenhouse effect is when the sun radiates around the earth.The greenhouse effect is the natural warming of Earth's lower atmosphere and surface. The 30% reflects back where the rest of the energy of the sun is collected by greenhouse effect and radiated to the surface again.

The radiation as well as the absorption of the heat is beneficial to the lower atmosphere as well as the surface as no other foundation can be reflected and radiated by the greenhouse effect.

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
To calibrate the x-axis for 14C decay, you have to convert half-lives to number of years. Recall that 14C has a single half-life
hjlf

Answer:

d. 28,650 years

Explanation:

Since 14C has a single half-life of 5,730 years

The number of years that is going to make up 5 half-lives for 14C will be;

5,730 years × 5 = 28,650 years

5 0
3 years ago
When a person is dehydrated, his or her iv fluids?
Lapatulllka [165]

When an individual is dehydrated, his or her intravenous fluids should be isotonic, because either a hypertonic or hypotonic IV would both cause damage to the individual’s red blood cells. Isotonic solutions are used: to increase the EXTRACELLULAR fluid volume because of blood loss, surgery, dehydration, fluid loss that has been loss extracellularly.

8 0
3 years ago
Which statement about air is correct?
Montano1993 [528]

Answer:

Air is essential for all organisms

7 0
3 years ago
Read 2 more answers
What factors increase the population
spayn [35]

Answer:

the major factor is the decrease of deaths

7 0
3 years ago
Read 2 more answers
Other questions:
  • 1. metal moderate ability to conduct heat and electricity; solid at room temperature; reacts with other elements 2. nonmetal gas
    13·1 answer
  • A boy is pushing on a heavy door, trying to slide it open. His friend stands behind him and helps him push. How have the forces
    10·2 answers
  • The salivation of dogs in pavlov’s experiments was significant because it ____.
    13·2 answers
  • Which characteristic is common to all prokaryotes and eukaryotes?
    12·2 answers
  • How do gastropods function as decomposers?
    14·1 answer
  • NEED HELP PLZZ ASAP
    9·1 answer
  • What do organisms in Kingdom Eubacteria have in common?
    11·1 answer
  • The cell membrane controls the traffic of molecules into and out of the cell, prevents the entry of toxic material into the cell
    12·2 answers
  • What is the name for the nonliving parts of an ecosystem? A. abiotic factors B. biotic factors C. biome factors D. aerobic facto
    6·2 answers
  • The epimysium of a muscle is composed of ______ connective tissue.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!