1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brums [2.3K]
4 years ago
5

What type of mutation results when a nucleotide is dropped from a DNA sequence?

Biology
1 answer:
Lemur [1.5K]4 years ago
7 0

Answer: Deletion

Explanation:

It may help to think about the question in terms of what is happening to the sequence.

It is being completely gotten rid of without a replacement so it is being deleted.

You might be interested in
One cause and one effect when dropping an egg 4 feet
olga55 [171]

Answer:

Cause: Dropping the egg

Effect: The egg breaks

Explanation:

Assuming there is no comfort for the egg when it reaches the ground or surface you're dropping it on, the egg will break. The egg breaks because you dropped it 4 feet, making the effect be the broken egg.

4 0
3 years ago
Please help. I'm going to fail omg.
Nataly_w [17]
I got you fam

1. Ee
2. DD
3. bb
4. Ww
5. ee
6. Dd
7. HH
8. hh
9. Ff
10. BB
11. homo dominant
12. homo recessive 
13. hetero
14. hair color 
15. freckles
PP. purple homo dominant 
Pp. purple hetero
pp. white homo recessive  
BB. brown homo dominant
Bb. brown hetero
bb. blue homo recessive 
RR. round seeds homo dominant
Rr. round seeds hetero
rr. wrinkled seeds homo recessive
TT. bobtails homo dominant
Tt. bobtails hetero
tt. no bobtail homo recessive 
8 0
3 years ago
Read 2 more answers
Which of the following boxes below represents a stable system? Describe how a disturbance to this box would affect it. Use the t
PtichkaEL [24]
The one with the equilibrium is the one with the diaomd because the cever is in the midily .
8 0
4 years ago
Read 2 more answers
A 60-year-old man has had painful skin with exfoliation of the skin and mucous membranes for 1 day. He has been taking allopurin
devlian [24]

Answer:

The correct answer is option E, that is, toxic epidermal necrolysis.

Explanation:

The painful exfoliation of the mucous membranes and the skin two weeks after starting allopurinol indicates Toxic Epidermal Syndrome. A potentially life-threatening dermatologic ailment featured by widespread necrosis, erythema, and bullous detachment of the mucous membranes and epidermis is known as the toxic epidermal necrolysis. The further leads to exfoliation, and possible death or sepsis.

7 0
4 years ago
Which of these statements is not an accurate description of females as identified by the 2000 census?
Margarita [4]
Census 2000 was the data collection for the census of the general population in 2000. China, United States, Costa Rica, Indonesia, Panama, Turkey and the USA conducted a census. According to the census results, the male population didn't grow at a faster rate than the female population.  
6 0
3 years ago
Other questions:
  • Which of the following adaptations does not protect tundra organisms from heat loss?
    15·2 answers
  • In which situation would the heterozygous phenotype be somewhere between (a blending of) the two homozygous phenotypes? a) co do
    6·1 answer
  • 5.) _______ is required for energy given to proteins in the phospholipid layer.
    10·1 answer
  • Excess heat can be removed from the body with the help of
    11·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Most scientific questions are based on??
    6·2 answers
  • If cells were fed glucose with radioactive 14c, what other molecule besides co2 would you expect to be radiolabeled? see section
    9·1 answer
  • Question 7 of 10 What is the product of meiosis |I? O
    15·2 answers
  • Which statement best explains the relationship between cellular respiration and photosynthesis?
    7·1 answer
  • Light energy is converted into this type of energy usable by all organisms
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!