1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sashaice [31]
4 years ago
9

Alicia often travels from the very hot climate of South Africa to her native North America. Which sensory receptor helps her adj

ust to the change in the temperature of her surroundings?
Photoreceptors



Mechanoreceptors



Thermoreceptors
Biology
2 answers:
Vinvika [58]4 years ago
7 0
Thermoreceptors, as they're nerve cells that have the abilty to detect difference in temperature
mylen [45]4 years ago
7 0

Answer:

Thermoreceptors

Explanation:

Thermoreceptors are the sensory receptors that are sensitive to changes in the temperature of surroundings. Thermoreceptors are one of the cutaneous receptors and are present in the dermis layer of skin.

The thermoreceptors present in Alicia' skin would sense the change in the temperature. This sensory information will be sent to the brain to produce the required responses to adjust to the surrounding temperatures.  

You might be interested in
What should students ALWAYS wear in the science laboratory? A) gloves B) slippers C) contact lenses D) safety goggles
VladimirAG [237]
You should always suppose to have safety goggles because you don't want to hurt your eyes
8 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Jupiter takes 4,332 Earth days to orbit the Sun, while Mercury takes 88 Earth days. Why is Mercury able to orbit the Sun more qu
Dmitry_Shevchenko [17]

Answer:

B) Mercury orbits much closer than Jupiter, so it feels the Sun's gravity more intensely.

Explanation:

4 0
2 years ago
What type of person is an entrepreneur?
Fed [463]
All above I think I don't know
6 0
3 years ago
What is the unit of analysis that can be inferred from the following hypothesis? hypothesis: with the introduction of dna eviden
earnstyle [38]

Guilty plead is the unit of analysis that can be inferred from the following hypothesis.

<h3>How do you analyze DNA evidence?</h3>

The overall method entails: the separation of DNA from a sample of evidence containing DNA of unknown origin; and, typically subsequently, the separation of DNA from a sample (such as blood) from a known individual; the processing of the DNA so that test results may be produced.

<h3>How has DNA analysis been used in criminal cases?</h3>

The analysis of biological evidence from the crime scene and comparison with criminal profiles in DNA databases can be used to identify the perpetrator in situations when a suspect has not yet been named. DNA databases can be used to connect crime scene evidence to other crime scenes.

To know more about crime visit :

brainly.com/question/9997722

#SPJ4

4 0
2 years ago
Other questions:
  • The metric system is a decimalized system of measurement used exclusively in the united states.
    11·2 answers
  • Which statement correctly compares the inheritance of blood type in humans and the inheritance of length of ears in corn plants?
    8·2 answers
  • If you wished to clearly observe the organelles inside of a white blood cell, which type of microscope would you choose?
    7·1 answer
  • If sol- means sun, which of these words means relating to or caused by the sun? A) polar B) socialize C) solar D) somber
    9·2 answers
  • HELP ME LABEL THESE ITS THE ONE WITH THE ANIMAL CELL
    10·1 answer
  • The simplest and most abundant form of life on Earth today are the
    13·1 answer
  • How does photosynthesis work step by step
    15·2 answers
  • What is the energy source that allows photosynthesis to occur?
    8·1 answer
  • Serena knows that scientists use physical similarities to classify organisms. She studies the figures of four different organism
    12·2 answers
  • Assign the various toppings you put on pizza to the appropriate domains and kingdoms. ...
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!