1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lesechka [4]
3 years ago
5

What’s is the substance that chromosomes are made from?

Biology
2 answers:
kari74 [83]3 years ago
7 0

Answer:

In the nucleus of each cell, the DNA molecule is packaged into thread-like structures called chromosomes. Each chromosome is made up of DNA tightly coiled many times around proteins called histones that support its structure.

Explanation:

Mars2501 [29]3 years ago
6 0
It’s made of dna and genes. Maybe not genes but definitely dna
You might be interested in
Please help me!! <br> thank you have a great day!
skelet666 [1.2K]

Answer:

Sentence 1: All organisms contain many cells

Explanation:

Some organisms, called unicellular organisms, only have one cell

4 0
2 years ago
Read 2 more answers
How do energetic considerations affect the structure of populations? communities? ecosystems?
alexandr402 [8]
<span>10% rule (efficiency between trophic levels): limits how long an ecosystem's food chain can be
Predator/prey cost benefit analysis (i.e. foraging) -- cost is risk of being eaten or killed along the way, benefit is energy/nourishment obtained: limits distribution of predator v. prey
Immigration/Emigration with other populations and ecosystems
Island biogeography: size of land and distance from another population/ecosystem (mainland): limits population size and variability on island</span>
3 0
3 years ago
A population of plans going on an island consist of two varieties ones with thorns in the other without over a period of many ye
IRISSAK [1]

problaby different gene mutations  and all that fancy stuff but yes  

4 0
3 years ago
Which mechanism of transport takes place without expending cellular energy?
irinina [24]
Passive 123456799483762
8 0
3 years ago
Read 2 more answers
What events are most likely to occur as a result of an earthquake?
Amiraneli [1.4K]
Destroyed buildings, fire, flooding I believe. 
7 0
4 years ago
Read 2 more answers
Other questions:
  • $569.65+12<br> 577.65<br> 540.65
    15·1 answer
  • Which of the chains of amino acids corresponds to the nucleotide sequence AAUGGCUAC?
    11·1 answer
  • Which term refers to the total dollar value of the goods and services produced in a country in a year?
    11·2 answers
  • Although most animals are bilaterally symmetrical, a few exhibit radial symmetry. What is an advantage of radial symmetry?
    7·2 answers
  • What element is all life based upon
    8·1 answer
  • Why is the probability of an earthquake so high in parkfield
    5·1 answer
  • Como podemos trasladar una caja de 50 kg desde planta baja hata un primer piso que presenta una inclinacion de 40º que tipo de m
    12·1 answer
  • What is a characteristic of the soil in secondary succession, which occurs in an area where the community has been destroyed?
    5·1 answer
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • [TG.04]One student designed an experiment to demonstrate the formation of a geologic feature. The steps of the experiment are li
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!