blood rich in oxygen enters the lungs through the pulmonary artery in where the alveoli within the lungs exchange carbon dioxide and oxygen so the carbon dioxide leaves your body.
Hope this helps a bit
Answer:
Genes & DNA
Explanation:
Heritable traits are known to be passed from one generation to the next via DNA, a molecule that encodes genetic information.Organisms inherit genetic material from their parents in the form of homologous chromosomes, containing a unique combination of DNA sequences that code for genes.
Answer:
#carry on learning
hope it's held
mark me as brainliest
All living cells need energy to function in order for the chemical reactions occurring in the cells to take place. In humans this energy is obtained by breaking down organic molecules such as carbohydrates, fats and proteins.
Answer:
Explanation:
Without the transformation of ATP to ADP our cells would not be able to produce any energy to function. also, all the mitochondria in the cells would die because this cycle is connected to the electron transport chain in which ions are converted.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
