1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
barxatty [35]
4 years ago
8

I need help with # 18!!!!!!

Biology
2 answers:
Brums [2.3K]4 years ago
7 0
I would say the correct answer would say B
Fiesta28 [93]4 years ago
6 0
I'm thinking it would be B but I'm not positive
You might be interested in
Disruption of which organelle, would cause the most change in the function of<br> the cell?
Allisa [31]

Answer:

Is it a true or false question cuz it would be true

8 0
3 years ago
If the pinsulin receptor, a, example of an integral membrane protein, is cotranslationally inserted into the ER membrane with th
kicyunya [14]

Answer:

The correct answer is option C.

Explanation:

As the proteins are produced in the endoplasmic reticulum membrane, they amalgamate with the vesicles and then they are conducted towards the membrane's cell surface where they act as an integral membrane protein.  

The outer end will bind with the ligand and the other one will get attached towards the cytoplasm. Thus, the pinsulin in the given case will combine with the C terminus of the protein.  

3 0
3 years ago
Why do scientific investigations lead to more questions?
zzz [600]

Answer:

D. They find more things that are not understood

Explanation:

After discovering something, scientist tend to find something related that sparks their curiousity.

5 0
3 years ago
A tragancio se le obstruyo el paso del jugo pancreatico al duodeno, se debioe. se alterara la digestion de las grasas sperar que
8_murik_8 [283]

Answer:

ecosistema terrestre es una comunidad de organismos y su ambiente que ocurre solo en masas de tierra, como continentes o islas. Ecosistemas terrestres. Tundra. Taiga. Bosque templado

8 0
3 years ago
Which of the following sequences is an example of a point mutation of the DNA sequence -A-A-G-T-G-C-?
uysha [10]

i think c. is the best answer , we just got off that topic like a week ago .


4 0
3 years ago
Other questions:
  • The more oxygen the muscles receive, the more energy you have.
    13·1 answer
  • Use the numbers 1, 2, 3, 4, and 5 to place the protein creation steps below in the correct order. Ribosome attaches to the mRNA.
    9·2 answers
  • How do you know that your pregnant? How long does it take to know if you are pregnant
    9·2 answers
  • Directions: Identify the differences between a fresh cut and a healed cut in the fruit.​
    6·1 answer
  • Andy is studying the effect of sunlight on the growth of plants. He selected three identical plants with a height of 15 cm for t
    9·1 answer
  • Hat is an ionic bond?
    11·1 answer
  • Can someone help me please and if you do can you write a paragraph about it
    9·2 answers
  • What is a disadvantage of sexual reproduction? *
    6·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Refer to the image below to explain ONE feedback mechanism between the biosphere and another of Earth’s spheres (geosphere, hydr
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!