1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notka56 [123]
4 years ago
12

SOMEONE EXPLAIN THIS FAMILY TREE TO ME?!?!?!

Biology
2 answers:
Molodets [167]4 years ago
6 0

John and Tina has Rick, Helen and Paul. Helen married Patrick and had Molly and Jason with him. Paul married Clair and they had 3 children; Phil, Ana, and Sue. If you have any questions, please ask, and mark brainliest if you can! Thanks so much!

11111nata11111 [884]4 years ago
5 0

I Can’t click the link

You might be interested in
Small rocky bodies that eventually form planets are called ____.
Bezzdna [24]
The answer is B. Asteroids
4 0
4 years ago
Please answer for me
Elanso [62]
It is B. three and five
6 0
3 years ago
Read 2 more answers
What is the single biggest challenge for living organisms in caves?​
Phantasy [73]

Answer:

light, what they can and connot see

Explanation:

4 0
3 years ago
Read 2 more answers
30 POINTS
NikAS [45]

Either these two, not sure

ATP is released during glycolysis as glucose is separated--it was stored in the chemical bonds.



Mitochondria stores energy, and cellular respiration "picks it up" during the process.

4 0
3 years ago
In addition to stealing energy
nadya68 [22]

Answer:

They can cause the deprivation of nutrients, fluids, and metabolites. this may also cause pathological effects in their hosts such as pathogenic effects.

3 0
3 years ago
Read 2 more answers
Other questions:
  • You are caring for a client with chronic respiratory failure. What are the signs and symptoms of chronic respiratory failure?
    13·1 answer
  • The biotechnological processes used by two geneticists are described below.Process A: Inserted herbicide-tolerant gene into a so
    10·1 answer
  • Most of the energy available to a consumer trophic level is uesed by organisms for..
    7·2 answers
  • What is the inducer molecule in the lac operon?
    13·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • The level of security in terms of the corresponding bit length directly influences the performance of the respective algorithm.W
    13·1 answer
  • What do plant cells have that animal cells<br> do NOT?
    10·1 answer
  • Describe the function of the following features in bringing about Movement in a snail muscles​
    5·2 answers
  • Can someone help me please?
    11·2 answers
  • Why do hens scream in the morning ?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!