<span>
It's solar, because s</span>olar energy is a renewable resource that is virtually endless as long as the sun shines.<span />
Answer:
Fracking can contaminate water supplies if it is not done properly, because the fracking fluid injected into rock to enable gas to be released often contains chemicals. If the borehole is not properly cased to stop leaks, the fracking water can escape into the aquifer
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
<span>When developing a strength-training program, and you want to increase muscular strength, you need to </span>eat a diet that promotes muscle strength. How? 1) Eat a lot of protein. 2) Get your calories from healthy sources and 3) Supplement your diet with m<span>any bodybuilders, different muscle-building products like creatine supplements. </span>
Answer:
No, genetically engineered organisms are engineered by humans. The plant evolved to be this way.
Explanation: