1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AlekseyPX
3 years ago
13

Which of the following is an example of a negative feedback altering homeostatic control? A) a person's heart rate drops as she

runs B) a person shivering as temperatures rise on a hot summer day C) the production of oxytocin (a hormone) increases as oxytocin levels rise in the body D) the concentration of salt in urine increases after eating a large bag of salty chips
Biology
1 answer:
galben [10]3 years ago
6 0

Answer:

Option D, the concentration of salt in urine increases after eating a large bag of salty chips

Explanation:

A negative feedback  reduces the activity causing any uncertain output that disturbs the homeostatic control. For example - if temperature of the body rises , signals are send via negative feedback loop to bring it down to normal body temperature.

Like wise when the concentration of salt in urine rises, we feel thirsty. Thus water is taken to cope up with the increased salt content in body after eating chips.

Here,  the activity (i.e eating of salty chips) disturbing homeostatic control is reduced by increasing the salt content in urine that makes the person thirsty.

Hence, option D is correct

You might be interested in
Which fuel has the shortest span of renewability?
Arte-miy333 [17]
<span> It's solar, because s</span>olar energy is a renewable resource that is virtually endless as long as the sun shines.<span />
6 0
3 years ago
Read 2 more answers
Define "Fracking" and ways it can alter/upset the water cycle.
Nata [24]

Answer:

Fracking can contaminate water supplies if it is not done properly, because the fracking fluid injected into rock to enable gas to be released often contains chemicals. If the borehole is not properly cased to stop leaks, the fracking water can escape into the aquifer

7 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
When developing a strength-training program, if you want to increase muscular strength, you need?
Free_Kalibri [48]

<span>When developing a strength-training program, and you want to increase muscular strength, you need to </span>eat a diet that promotes muscle strength. How? 1) Eat a lot of protein. 2) Get your calories from healthy sources and 3) Supplement your diet with m<span>any bodybuilders,  different muscle-building products like creatine supplements. </span>

7 0
3 years ago
Is a plant that has the natural ability to protect itself against predation a genetically engineered organism
Snezhnost [94]

Answer:

No, genetically engineered organisms are engineered by humans. The plant evolved to be this way.

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • During which phase of mitosis does cytokinesis take place
    14·1 answer
  • Which of the following is true about biochemistry?
    5·2 answers
  • BIOLOGY HELP PICTURE BELOW
    13·1 answer
  • Help with the questions above? Super easy! But thanks!! ❤️
    8·1 answer
  • Draw the Punnett squares and write out the phenotypes pls ??☺​
    12·1 answer
  • Why do we use arrows when creating a food web? What do they represent?
    14·1 answer
  • Plants conduct _____.
    8·2 answers
  • What is one negative effect of human influence on cycles of matter?
    13·2 answers
  • Imagine that you have discovered a new species that has the ability to consume other organisms for energy and also contains chlo
    15·1 answer
  • Need help with the top question :p
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!