The stage of the cell cycle where the nucleus divide into two nuclei is called telophase or cytokinesis
please mark as brainliest
<span>A::T and G:::C is essential. The importance to the DNA structure is that prevents lose of genes and mis-formation of encoded products (protein and mRNA).</span>
Answer:
The right approach will be "Natural selection".
Explanation:
- Natural selection seems to be a mechanism that persists and reproduces populations of organisms that seem to be better suited to applications, however those that are somewhat properly equipped die away.
- This demonstrates that organisms that really can respond to a given climate can rise in quantities and therefore will ultimately outperform certain species that are unable to respond significantly.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
When blood is drawn from a blood vessel in your arm, it is dark red. This color indicates that the blood was taken from the vein.
Why was my blood so dark when drawn?
Hemoglobin, a protein found in blood cells that enables the delivery of oxygen throughout the body, contains iron, which gives human blood its red color. However, the amount of oxygen in the blood affects the hue. Blood that contains a lot of oxygen will appear bright red. If blood is drawn from an artery that transports blood from the lungs to the rest of the body, this is typical.
Deoxygenated blood is contained in the veins, which carry blood back to the lungs from the body. Based on the light wavelengths they reflect, chemicals appear to our eyes in specific colors. As blue-green light is absorbed by hemoglobin attached to oxygen, red-orange light is reflected into our eyes, giving the appearance of redness. Because of this, when oxygen attaches to iron in the blood, the color turns brilliant cherry red. Blood is a deeper shade of red when it is not coupled to oxygen.
Learn more about the Vein here:
brainly.com/question/9712112
#SPJ4
