1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SVEN [57.7K]
3 years ago
13

What drug that is not an antibiotic is approved for the specific indication of sepsis because of its anticoagulant properties?

Biology
2 answers:
enyata [817]3 years ago
8 0

Xigris (Drotrecogin alfa) is not an antibiotic but is approved for the specific indication of sepsis because of its anticoagulant properties.

Xigris (Drotrecogin alfa) is a drug approved by the Food and Drug Administration for the reduction of mortality in adult patients with severe sepsis who have a high risk of death. Xigris (Drotrecogin alfa) is placed under the class of serine proteases and it has anticoagulant, anti-thrombotic, anti-inflammatory, and profibrinolytic properties.


SVEN [57.7K]3 years ago
5 0

Answer;

Drotrecogin Alfa (xigris)

Explanation;

Xigris (drotrecogin alfa (activated)) is a recombinant form of human activated protein C. Drotrecogin alfa (activated) is a serine protease with the same amino acid sequence as human plasma-derived activated protein C.

Xigris (drotrecogin alfa)  is indicated or used  for the reduction of mortality in adult patients with severe sepsis (sepsis associated with acute organ dysfunction) who have a high risk of death.

You might be interested in
3. — A seed can be round or wrinkled.
Umnica [9.8K]

Answer:

im pretty sure it would be a trait

8 0
2 years ago
Read 2 more answers
A virus cannot reproduce on its own. Viral DNA or RNA must enter the host cell and direct the cell to make the materials needed
Yuliya22 [10]

In both cases, viral DNA is integrated into the host DNA for a period of time

3 0
3 years ago
Read 2 more answers
Which is an example of a root?
Olegator [25]

Explanation:

Here are more examples of roots, their meanings, and other words that are formed by adding prefixes and/or suffixes to these language building blocks: Ambul: to move or walk (amble, ambulance, ambulate) Cardio: heart (cardiovascular, electrocardiogram, cardiology) Cede: to go or yield (intercede, recede, concede)

I hope it will help you....

4 0
2 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Is the surface temperature of white dwarf stars higher or lower than red super giants?
finlep [7]
<span>The surface temperature of white dwarf stars is higher than that of red super giants. White dwarf stars are extremely hot when they form, and they start cooling off as time goes by. Red supergiants, on the other hand, are enormous dying stars, and they are quite cool. So, having this in mind, white dwarves are hotter than red supergiants. Hope I helped! :) Cheers!</span>
8 0
3 years ago
Other questions:
  • HELP PLS
    6·1 answer
  • What is fried miescher credited with?
    11·2 answers
  • Which of the following best describes the role of an enzyme in living organisms ​
    14·1 answer
  • Observation on woodlice
    11·1 answer
  • You visit Antarctica on a cold, breezy morning as part of an exploration mission to save the Polar bears. Your team sees a polar
    5·1 answer
  • (ASAP)
    6·2 answers
  • Why are proteins considered organic molecules?
    9·1 answer
  • An amoeba uses a sugar molecule during metabolic activity. It loses energy to the environment as a result. The transformation of
    5·1 answer
  • HELP!
    11·1 answer
  • Summarize the results of your experiments.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!