1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LenaWriter [7]
3 years ago
10

The individual cells making up a tissue differ from single-celled organisms such as Paramecium in that only the latter:

Biology
1 answer:
Umnica [9.8K]3 years ago
3 0

Answer:

C. are capable of extended independent life.

Explanation:

The single-celled organisms such as Paramecium have only one cell in their bodies. The cells of the unicellular organisms are capable of independent existence as an individual organism. On the other hand, the cells that make up a tissue are not able to survive as an individual organism. The cells of the tissue are specialized to perform some specific functions and cannot perform all the life process independently as the single cell of Paramecium does.

You might be interested in
The physical appearance physical appearance of trait is called the of trait is called the
ANEK [815]
The physical appearance of a trait is called the phenotype of an organism.
8 0
4 years ago
Read 2 more answers
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
Why can’t your body heal an amputation the same way it can heal a cut?
Pani-rosa [81]

Answer:

because the mother sells are less for that kind of cuts so they don't regenerate and in a cut its easier because they are just in number for that cut

Explanation:

8 0
3 years ago
17. Which of these make up the primary link between a gene and the expression of a trait?
WARRIOR [948]

Answer:

sugars

Explanation:sugers because they are bad to health

3 0
3 years ago
Read 2 more answers
How is local weather impacted by jet streams shifts?
Bess [88]

Discover how strong winds high above the earth called "jet streams" are responsible for steering all weather to and away from us.

4 0
4 years ago
Other questions:
  • Of the three ways in which energy is transported in nature, which two are important in the sun
    15·1 answer
  • Compounds not produced by living organisms are called
    9·1 answer
  • Looking through a light microscope at a dividing cell, you see two separate groups of chromosomes on opposite ends of the cell.
    13·1 answer
  • HELP 1 QUESTIONN BIOLOGY
    12·1 answer
  • Edxcel alevel biology past papers: some of the blood plasma of individuals who have survived infection wtih Ebola can be collect
    6·1 answer
  • When electrons are removed from a food molecule, it is
    14·1 answer
  • The mass of an object doubles. What happens to the gravitational force between it and another object whose mass stays the same,
    15·1 answer
  • Is there a way to know any test exam style questions for 9th grade biology because biology is a very complex subject and lots of
    10·1 answer
  • Once potential energy has been converted into kinetic energy, one of two things can happen. The kinetic energy may be and made u
    8·1 answer
  • each of the main types of biological macromolecules (proteins, nucleic acids, carbohydrates, and lipids) are polymers of specifi
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!