1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jenyasd209 [6]
3 years ago
10

Consider the population of four juvenile condors their weights in pounds are

Biology
1 answer:
juin [17]3 years ago
6 0
Their weights in pounds are 5, 7, 10, 11.
You might be interested in
The bee's wings are moving very fast The bee's wings are much smaller than its body. Which question is based on these observatio
postnew [5]

How much energy does it take a bee to fly for 10 seconds

8 0
3 years ago
Read 2 more answers
Which forage crop do honey bees favor for its nectar
n200080 [17]
<span>For bees, their forage or food supply consists of nectar and pollen from blooming plants within flight range</span>
8 0
2 years ago
What does BAC stand for
Alenkasestr [34]

Answer:

blood alcohol concentration

Explanation:

we studied that recently so I could recall

5 0
3 years ago
7. All the virus has circular nucleic acid. True or False?​
ELEN [110]

Answer:

The genome is usually organized as a single linear or circular molecule of nucleic acid

Explanation:

6 0
3 years ago
What functional group is commonly used in cells to transfer energy from one organic molecule to another?
Alja [10]

<u>Answer:</u>

ATP or the Adenosine Triphosphate is the energy currency of the living world, which transfers energy from one organic molecule to other, even from one cell organelle to other.

<u>Explanation:</u>

The functional group of ATP is phosphate which is quite evident from its name.

Adenosine diphosphate is the parent molecule. During either photophosphorylation or the respiration, the Inorganic phosphate molecule that is present in the cellular fluid gets attached to the parent molecule ADP via a high energy bond which is broken to give energy to the normal reactions.

4 0
3 years ago
Other questions:
  • Which of the following is an example of an adaptation?a. In a vey wet year some plants grow unusually tall stalks and large leav
    12·1 answer
  • Please discuss why it is important to represent your scientific data in the best format.
    6·1 answer
  • 1. Who influenced Darwin's idea that life could change slowly over a period of time?
    10·2 answers
  • Which characteristic is present in marsupials but absent in reptiles?
    13·1 answer
  • Which of the following is true about the efficiency of energy transfer in an ecosystem?
    10·2 answers
  • ________ is a prolonged period of abnormally high temperatures, usually in association with humid weather.
    5·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What role did the detergent play when added to the strawberry solution?
    10·1 answer
  • 3.<br> What two molecules are produced during Photosynthesis?
    15·2 answers
  • What is the scientific term for rocks formed from lava?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!