1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lorico [155]
3 years ago
15

Explain how the amount of DNA does not relate to how complex an organism is

Biology
1 answer:
Phoenix [80]3 years ago
5 0
The amount of DNA present in the system of an organism that does not necessarily relate to how complex that certain organism is. There are single-celled microorganism with very few amount of DNA but are very complex with respect to arrangement of certain amino acid component of the DNA strands. 
You might be interested in
The reapeating units (monomers) of dna are called what?​
pentagon [3]
The monomers of DNA consist of nucleotides , and polymer.
4 0
3 years ago
Read 2 more answers
N men, anabolic steroids cause select one:
vodomira [7]
A shut down of normal testosterone production
5 0
3 years ago
Molecules that do not contain carbon are called inorganic.<br><br> true or false
zavuch27 [327]

Answer:

The answer is false

Explanation:

because most carbon are harmful and are added by humans

3 0
3 years ago
When an organism encounters nitrate in its environment, which condition will determine whether the nitrate is used in an assimil
Arada [10]

Answer:

Dissimilatory- oxygen absent

Assimilatory- high concentration of nitrite

Explanation:

In assimilatory nitrate reduction, ammonium is produced and subsequently incorporated into biomass to build up e.g., proteins and nucleic acids. Dissimilatory nitrate reduction is a process for energy conservation, in which nitrate is used as an electron acceptor in the (near) absence of oxygen . Dissimilatory nitrate reduction and nitrate storage in particular are physiological life traits that provide microbes with environmental flexibility (i.e., metabolic activity under both oxic and anoxic conditions) and resource independence (i.e., anaerobic metabolism without immediate nitrate supply), respectively. Such life traits are especially important in environments that are temporarily anoxic and/or nitrate-free and they may have developed as a “life strategy” in both prokaryotes and eukaryotes

4 0
3 years ago
Explain how wolves can be used as a biological indicator of the overall health of the ecosystem?
8090 [49]
<span>Large carnivores in general are often used as indicator species because of their seat at the top of the food chain. ... When a large carnivore is missing from an ecosystem this can reflect problems in prey populations, usually caused by larger issues such as over-harvest of game, presence of disease, or habitat changes.</span>
4 0
4 years ago
Read 2 more answers
Other questions:
  • All living organisms on Earth are similar because they:
    8·1 answer
  • How are fossils formed
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The term anatomy refers to _____.
    6·1 answer
  • What is copied during replication<br><br> A. mRNA<br><br> B. tRNA <br><br> C. rRNA <br><br> D. DNA
    11·2 answers
  • A mineral forms from water at the edge of a lake. Which statement best describes this mineral? The mineral formed from lava. The
    10·2 answers
  • Which element has exactly 29 electrons and is in period 4
    9·1 answer
  • The chromosomal abnormality in which a fragment of a chromosome breaks off and then reattaches to the original chromosome in the
    7·1 answer
  • Cells may have different shapes and different amounts of organelles, depending on their function.which features do plant cells h
    15·1 answer
  • Hello! Im looking for someone to answer this correctly this will mean a lot :)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!