1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tju [1.3M]
3 years ago
8

If a DNA molecule is compared to a spiral staircase what parts makes up the steps

Biology
2 answers:
Burka [1]3 years ago
8 0
<span>pairs of nitrogen bases.  I hope It will halp
</span>
lyudmila [28]3 years ago
8 0

Nucleobases A T G C

And the nitrogen bound makes em shape as pairs in the steps of a DNA

You might be interested in
These are four types of feathers found in birds. The structure of these feathers is most likely composed of...
goldfiish [28.3K]
It would be C because hair and feathers and what not are made from the protein keratin.
8 0
3 years ago
Read 2 more answers
Coastal urbanization does not increase the risk to human communities from which of the following natural disasters?
True [87]
The answer is a.Earthquakes
7 0
2 years ago
Does the study of disease require Science? If yes, why?
Stella [2.4K]
First of all science is needed to study most things including diseases and this is so since the study of diseases would require a research organism of course and this is any creature that scientist would use to study life and so without science this would not be possible as science allows for the study of animals and humans which are likely to be vectors and diseases requires epidemiology which are scientific disciplines similar to biology to better understand the disease processes and so science is definitely needed.
7 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Single Antigen, Multiple Organs Some Type-II immunopathology mediated autoimmune diseases have manifestations in multiple differ
Bumek [7]

Answer:

Adaptive immune responses are triggered by activation of antigen-specific T cells that produce antibodies against foreign antigens such as, for example, harmful viruses. These immune responses are useful to eliminate dangerous molecules from the body. In a normal immune reaction, the antibodies produced by T-cells target antigen molecules in order to be subsequently absorbed by phagocytic macrophage cells.

Autoimmune diseases are triggered by the response of the adaptive immune system against self-antigen molecules. Since the immune system can not eliminate antigens from the own body, this immune reaction generates an excessive inflammatory response, and it may lead to the damage of tissues and organs.

4 0
3 years ago
Other questions:
  • According to chargaffs base pairing rules,the percentages of ___ are equal to those of thymine and the percentages of ___ are eq
    13·2 answers
  • Sensory cells in the human eye can detect changes in light. The information obtained from these sensory cells is transmitted to
    7·1 answer
  • What kind of cells are in only plants
    12·1 answer
  • What are actual characteristics that organisms share?
    5·1 answer
  • Jill is 5 years old. She has been diagnosed with ADHD and shows signs of learning disabilities. Her doctor suggests that Jill's
    11·1 answer
  • Which of the following is a solution?
    10·2 answers
  • Consuming alcohol inhibits the release of ADH. As a result __________.
    12·1 answer
  • 18. Why does DNA Replication have to happen at this stage of the cell<br> cycle? *
    12·1 answer
  • Important tasks a cell must complete to divide
    8·2 answers
  • As cell size increases the surface area to volume ratio
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!