1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
son4ous [18]
4 years ago
8

 In which of the following situations is salinity highest? 

Biology
1 answer:
alexdok [17]4 years ago
7 0
C) evaporation exceeds precipitation 

You might be interested in
How would you describe animal-like-protists?<br> A. two-celled<br> B. no-celled<br> C. one-celled
lyudmila [28]
C. one celled 
because like animals they can move and are hetrotrauphs 
8 0
3 years ago
[Simple question][please answer]
fenix001 [56]
<span> <span><span> <span> Ants and Mice/Rats         </span></span><span><span>Cow          </span></span><span><span>Beetle        </span></span><span><span>Beetles       </span></span><span><span>Chuckwalla and Gila Monster           </span></span><span><span>Coyotes and snakes        </span></span><span><span>Snakes            </span></span><span><span>Lizards and snakes           </span></span><span><span>Tarantulas           </span></span><span><span>hawks           </span></span><span><span>Coyotes        </span></span><span><span>Coyotes         </span></span><span><span>Bacteria         </span></span><span><span>hawks            </span></span><span><span>Springtails </span> </span> </span></span>
5 0
3 years ago
Read 2 more answers
Mark is interested in becoming a biomedical engineer or a journalist. Based on his research, he chose to pursue biomedical engin
vesna_86 [32]
The answer is letter B. because he is interested in designing machines that help people with disabilities. Becoming a biomedical engineer is one of his choice and probably he was inspired by people with disabilities because of his passion in writing also. In order for him to help these people, he decided to become a biomedical engineer to create technologies to lessen the burden of these people.
5 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Hurry help me! the first person to answer gets brainest :)
alina1380 [7]

Answer:

A: Golgi apparatus

B: vacuole

C: mitochondrion

D: nucleus

E: cell membrane

3 0
3 years ago
Other questions:
  • The heart rate slows, breathing becomes more shallow and irregular, and an eeg would show the first signs of sleep spindles in _
    11·1 answer
  • Enzymes are typically which type of biomolecule
    14·1 answer
  • How are sound energy and light energy similar?
    8·1 answer
  • Which statement would least likely be used to describe variation?
    9·1 answer
  • Why DNA replicates from 5' to 3' ?​
    15·1 answer
  • What would we need to do to increase the plant biomass on Earth? List about two solutions ​
    5·1 answer
  • What stage of photosynthesis uses
    8·1 answer
  • How cells, tissues, organs, and organ systems<br> are related
    8·1 answer
  • Is the chromosome number related to the complexity of the<br> organism?
    7·1 answer
  • In a quiz
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!