The Sun is the primary source of energy for Earth's climate system is the first of seven Essential Principles of Climate Sciences.
Principle 1 sets the stage for understanding Earth's climate system and energy balances.
The Sun warms the planet, drives the hydrologic cycle, and makes life on Earth possible.
<span>Notice a couple of things
different between (A) and (B). It was NOT the first time a biologist
proposed that species changed through time (so it's not B). But it
finally *solidified* that idea by giving "change through time"
(evolution) a MECHANISM. It gave a plausible explanation for WHY
species change over time, in a testable way that made sense and had
evidence to support it.
So it finally dismissed the idea that species are constant.
It also emphasized that the simple presence of *variation* within a population was a key reason for evolution.
While we're at it ... (C) is wrong because it's not *individuals* that
acclimate (adapt) to their environment, but the population (the species)
as a whole.
And (D) is wrong because it had nothing to do with economics or the monarchy.</span>
I think the answer is most likely be J.
The first (F) one the population of the predator increases hugely while the population of the prey was neutral. And so both population didn’t seem to have any connection. Same goes for H. Graph G doesn’t make sense at all the population of the prey didn’t exist throughout the time in the graph but only exist in one single point of time and then just vanish again so that shouldn’t be the answer either.
In graph J, you can see the correlation between the two populations as the predator goes up and so does the prey.
You can search up on google predator-prey relationship graph to get better understanding.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
