1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qwelly [4]
3 years ago
5

During which eon did Pangaea come together?

Biology
2 answers:
Fudgin [204]3 years ago
8 0
Phanerozoic is the answer
Alik [6]3 years ago
3 0

Answer:

Phanerozoic

Explanation:

Phanerozoic

You might be interested in
Ta bien mi respuesta •w•'''' ?
Margaret [11]

Answer:

yes

Explanation:

that is the answer I think so.

3 0
3 years ago
david buss, an evolutionary theorist, has attributed the big five personality traits to evolved ancestral needs. please select t
guajiro [1.7K]
It is a true statement that <span>David buss, an evolutionary theorist, has attributed the big five personality traits to evolved ancestral needs. The correct option among all the options that are given in the question is the first option. I hope that this is the answer that has actually come to your desired help.</span>
4 0
4 years ago
Read 2 more answers
Where do DAG and IP3 originate?
cupoosta [38]

Answer:

Option (4).

Explanation:

Phosphatidylinositol4,5-bisphosphate (PIP2) is the phospholipid present in plasma membrane. This lipid is important for the cell communication and cell signalling process.

The PIP2 can cleave and give two main products are DAG (diacylglycerol) and IP3 ( inositol 1,4,5-trisphosphate). These two molecules are important for the cell signalling.

Thus, the correct answer is option (4).

8 0
3 years ago
What is meant by a gateway substance? what is one example of a gateway substance what is wrong with assuming that use of a gatew
saw5 [17]
A gateway substance is something that may be menial but could lead to something bigger, an example is weed in the drugs world, weed is not hard to get and is usually a gateway drug to stronger types of drugs and potentially more dangerous
6 0
3 years ago
Read 2 more answers
List the steps of DNA replication from start to finish
Rus_ich [418]

Answer:

2,4,3,1..............

8 0
3 years ago
Other questions:
  • Which of the following is not true of gene
    10·1 answer
  • Assume that Tay-Sachs disease only affects homozygous recessive individuals. If two parents are carriers, what are the chances t
    10·1 answer
  • What is the function of the enzymes helicases in dna replication?
    10·1 answer
  • In a hypothetical situation, a certain species of flea feeds only on pronghorn antelopes. In thewestern United States, pronghorn
    7·1 answer
  • How did endosymbiosis impact the structural differences between bacteria, animals, plants and fungi?
    5·1 answer
  • What would be an example of a consumer
    14·1 answer
  • Group of students kept track of the number of
    11·2 answers
  • Which monosaccharides and polysaccharide is found in the human body
    7·1 answer
  • The special job an organism plays in it's ecosystem is it's __________.
    12·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!