1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ann [662]
3 years ago
12

Skeletal muscle fibers are classified as ""fast"" or ""slow"" based upon what factor?

Biology
2 answers:
andrey2020 [161]3 years ago
6 0

Answer:

Skeletal muscles fibre are classified base on how the produce energy.

Explanation:

Skeletal muscles fibres consist of bundles of cells that form muscles which contain myobrills.

Skeletal muscles are classified based on how the produce energy;

Type 1 or slow pitch muscle fibres are more efficient and last for a long period of time. They are use for postural maintenance or endurance. It use aerobic respiration to produce energy or ATP.

Type 11 or fast twitch muscle fibres use anaerobic respiration and are for short speed and fatigue more easily than type 1.

Inessa05 [86]3 years ago
5 0

Answer:

The speed of the myosin ATPase.

Explanation:

Myosin ATPase is actually considered as molecular motor of muscle cells because it converts chemical energy into directional movement.

ATP comes and bind with the myosin. Now, it is in high-energy state. ATPase hydrolyzed the ATP into ADP by releasing of inorganic phosphate (Pi).

When myosin binds with the actin, then ATPase convert ATP into ADP and this chemical energy converts into directional movement (contraction) of muscle cells.

Myosin ATPase speed depends on the shortening of respective muscle. ATPase activity are higher when intrinsic speed increases.

You might be interested in
Which statement explains how the fossil record supports the theory of evolution?
mr_godi [17]

It's B

Explanation:

Because the fossil record shows how organisms have evoluate from relatively simple organisms to more complex organisms

4 0
3 years ago
Read 3 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Based on this diagram, do you think that organisms of the same order will share a stronger evolutionary
dlinn [17]

From the diagram above, I dont think that organisms of the same order share a stronger evolutionary relationship than organisms in the same phylum. This is because, after kingdoms, the subsequent categories of increasing specificity are: phylum, class, order, family, genus, and species.

<h3>Levels in taxonomic classification</h3>

At each sublevel in the taxonomic classification system, organisms become more similar.

Organisms that share similar physical features and genetic sequences tend to be more closely related than those that do not.

Scientists use a tool called a phylogenetic tree to show the evolutionary pathways and connections among living organisms.

<h3>Phylogenetic tree</h3>

A phylogenetic tree is a diagram used to reflect evolutionary relationships among organisms or groups of organisms

<h3>Taxonomical classification</h3>

Taxonomy is the scientific study of naming, defining and classifying groups of living organisms based on shared characteristics. There are seven main taxonomic ranks:

  • kingdom
  • phylum ( in animals )or division ( in plants )
  • class
  • order
  • family
  • genus
  • species.

Learn more about taxonomy:

brainly.com/question/2375388

3 0
2 years ago
Which is a type of plankton? A. shark B. squid C. algae D. crab
d1i1m1o1n [39]
Algae because it is a small  organism that the larva state of animals live in and feed on it 

3 0
3 years ago
Read 2 more answers
Describe the motion shown in the lines
Bogdan [553]

Answer:

Solution

For figure (a)

During interval AB Velocity is +ve, so the particle is moving in +ve direction, but it is slowing down as acceleration (slope of v-7 curve) is negative.

During interval BC Particle remains at rest as the velocity is zero. Acceleration is also zero.

During interval CD Velocity is -ve, so the particle is moving in -ve direction and is speeding up as acceleration is also negative.

For figure (b),

During interval AB Particle is moving in +ve direction with constant velocity and acceleration is zero.

During interval BC Particle is moving in +ve direction as velocity is +ve, but it slows down until it comes to rest as acceleration is negative.

During interval CD Velocity is -ve so the particle is moving in -ve direction and is speeding up as acceleration is also negatived

5 0
2 years ago
Other questions:
  • There are two different alleles for flower color, P and p. The image shows a white sweet pea that is labeled with its two allele
    10·2 answers
  • Why is the presence of cancer cells so harmful to the body?
    5·2 answers
  • Identify and explain three major issues that cut across psychology
    11·1 answer
  • _____ helps regulate water and electrolyte balance. med term
    14·1 answer
  • Scientists can track the movement of proteins through the endomembrane system using an approach known as a pulse-chase experimen
    13·1 answer
  • How did earthquakes contribute to the destruction of over seventy villages in Tibet? (site 1
    11·1 answer
  • I have a 62% rn on my credit recovery and so i have to repet the year but if i get a good score on this quiz maybey ill get a 63
    8·1 answer
  • What was the ecosystems carrying capacity for Buffalo based on the graph once rinderpest was eliminated
    12·1 answer
  • Which physical properties do all-stars have? Check all that apply.
    6·1 answer
  • Why is still water an ideal environment for the formation of mold and cast fossils?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!