1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
neonofarm [45]
3 years ago
13

Which resident's information would the scientist most likely record to get valid results?

Biology
1 answer:
pentagon [3]3 years ago
3 0
Resident 1 is to give the most valid results. 
You might be interested in
Compare and contrast the terms living and biotic
NeX [460]
Both the terms "living" and "biotic" describe an organism that holds life. However, an organisms stops "living" after it dies, but never stops being "biotic". This is because "biotic" means anything that has ever had life, whereas "living" only describes things currently alive.
5 0
3 years ago
Sean outperforms the other air traffic controllers. Through his tremendous focus and attention, he accurately detects three time
enyata [817]

Answer:

In the mentioned scenario, norepinephrine and acetylcholine are the neurotransmitters, which would have been present at the higher concentrations in Sean's brain. Norepinephrine signifies to a neurotransmitter that plays an important part in dreaming, emotions, sleeping, attentiveness, and learning.  

It also gets released in the bloodstream as a hormone, where it augments the rate of heart and causes the blood vessels to contract. Another neurotransmitter called acetylcholine signifies the chemical that is released by the motor neurons to instigate the muscles.  

3 0
3 years ago
The _____ theory explains how our universe became so structured and uniform.
Georgia [21]
<span>Inflation theory is the theory explains why our universe is structured and uniform and suggests that the universe is flat in shape. According to that theory, the universe expanded exponentially fast for a fraction of a second after the Big Bang.</span>
8 0
3 years ago
Read 2 more answers
How is a protein's shape related to its function?​
Leokris [45]

Answer:

"A protein's specific shape determines its function. If the three-dimensional structure of the protein is altered because of a change in the structure of the amino acids, the protein becomes denatured and does not perform its function as expected."

Explanation:

Just finished my research, I hope the answer above can help you

8 0
3 years ago
Once absorbed the majority of glucose is transported to
ycow [4]

Answer: Liver

Glucose is the most important fuel source for the body, specifically the brain. It is absorbed through the mucosal lining into the epithelial cells of the intestine by active transport via sodium-dependent hexose transporter. From the epithelial cells, glucose is moved into the surrounding capillaries by facilitated diffusion into the liver. Once in the liver, glucose is stored as glycogen.

6 0
3 years ago
Other questions:
  • A student creates a model of a closed ecosystem by filling a glass tank half full with water then addin 10 snails and two small
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Temperatures sunlight and water are examples of what
    6·1 answer
  • Which of the following objects is usually the smallest?
    9·2 answers
  • ______ DNA is held within the cell's nucleus.
    15·2 answers
  • The action by which a plant grows toward sunlight is called
    11·1 answer
  • Which type of plant makes up the largest group in the Plantae kingdom?
    8·1 answer
  • Which of these actions is likely to prevent the spread of pathogens in the environment?
    13·2 answers
  • It is a state of well-being when all internal and external body parts, organs, tissues and cells can function properly as they a
    8·2 answers
  • Which of the following statements correctly describes the genetic material inside a virus?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!